Rmu_sc0000627.1_g000001

NLI interacting factor-like phosphatase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000627.1
Physical Location & Seq
Forward (+)
1 .. 476
476 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000627.1_g000001.1.cds

Sequence Viewer

Length: 222 bp
gctcacacagccatctttcctcctgaatacaaggttgaccaagttgatgacaaggctttaggtcctaatggtgagttgaggctttacttggagggacttgcagatgccgatgatgttacttcttatgttaaagatcatccatttggacagccagcaataacaactactcactcagattgggatttctattcaaagatccttactcattgccagaaagattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.21

Weight (kDa)

4.72

Isoelectric Point (pI)

14.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 190
AgsI TTSAA 1 cut(s) 192
AlwI GGATC 1 cut(s) 190
AspS9I GGNCC 1 cut(s) 62
AsuHPI GGTGA 1 cut(s) 83
AvaII GGWCC 1 cut(s) 62
BccI CCATC 1 cut(s) 20
Bme18I GGWCC 1 cut(s) 62
BmgT120I GGNCC 1 cut(s) 62
BmsI GCATC 1 cut(s) 94
Bse3DI GCAATG 1 cut(s) 205
BseGI GGATG 1 cut(s) 136
BseMI GCAATG 1 cut(s) 205
BseMII CTCAG 1 cut(s) 186
BslFI GGGAC 1 cut(s) 108
BsmFI GGGAC 1 cut(s) 108
Bsp143I GATC 2 cut(s) 133, 195
BspCNI CTCAG 1 cut(s) 185
BspPI GGATC 1 cut(s) 190
BsrDI GCAATG 1 cut(s) 205
BssMI GATC 2 cut(s) 133, 195
BstC8I GCNNGC 1 cut(s) 153
BstDEI CTNAG 1 cut(s) 172
BstF5I GGATG 1 cut(s) 136
BstKTI GATC 2 cut(s) 136, 198
BstMBI GATC 2 cut(s) 133, 195
BstMWI GCNNNNNNNGC 1 cut(s) 8
BstX2I RGATCY 1 cut(s) 195
BstYI RGATCY 1 cut(s) 195
BtsCI GGATG 1 cut(s) 136
Cac8I GCNNGC 1 cut(s) 153
Cfr13I GGNCC 1 cut(s) 62
CviJI RGCY 4 cut(s) 11, 56, 82, 151
CviKI_1 RGCY 4 cut(s) 11, 56, 82, 151
DdeI CTNAG 1 cut(s) 172
DpnI GATC 2 cut(s) 135, 197
DpnII GATC 2 cut(s) 133, 195
Eco47I GGWCC 1 cut(s) 62
EcoO109I RGGNCCY 1 cut(s) 62
FaiI YATR 1 cut(s) 126
FaqI GGGAC 1 cut(s) 108
FokI GGATG 1 cut(s) 123
HincII GTYRAC 1 cut(s) 37
HindII GTYRAC 1 cut(s) 37
HphI GGTGA 1 cut(s) 83
Hpy166II GTNNAC 1 cut(s) 37
Hpy188I TCNGA 1 cut(s) 175
Hpy188III TCNNGA 1 cut(s) 23
Hpy8I GTNNAC 1 cut(s) 37
HpyCH4V TGCA 1 cut(s) 101
HpyF10VI GCNNNNNNNGC 1 cut(s) 8
HpyF3I CTNAG 1 cut(s) 172
Kzo9I GATC 2 cut(s) 133, 195
LpnPI CCDG 2 cut(s) 36, 165
LweI GCATC 1 cut(s) 94
MaeIII GTNAC 1 cut(s) 115
MalI GATC 2 cut(s) 135, 197
MboI GATC 2 cut(s) 133, 195
MflI RGATCY 1 cut(s) 195
MnlI CCTC 3 cut(s) 30, 72, 85
MseI TTAA 2 cut(s) 129, 220
MwoI GCNNNNNNNGC 1 cut(s) 8
NdeII GATC 2 cut(s) 133, 195
PpuMI RGGWCCY 1 cut(s) 62
Psp5II RGGWCCY 1 cut(s) 62
PspPI GGNCC 1 cut(s) 62
PspPPI RGGWCCY 1 cut(s) 62
PsuI RGATCY 1 cut(s) 195
SaqAI TTAA 2 cut(s) 129, 220
Sau3AI GATC 2 cut(s) 133, 195
Sau96I GGNCC 1 cut(s) 62
SetI ASST 2 cut(s) 36, 64
SfaNI GCATC 1 cut(s) 94
SgeI CNNG 7 cut(s) 35, 43, 53, 64, 100, 110, 164
SinI GGWCC 1 cut(s) 62
Tru1I TTAA 2 cut(s) 129, 220
Tru9I TTAA 2 cut(s) 129, 220
VpaK11BI GGWCC 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.