Rh3BG201900

NLI interacting factor-like phosphatase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
18006485 .. 18007774
1290 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG201900.1

Sequence Viewer

Length: 438 bp
ATGGCTGAAAAGAATAAAAGCAAAGTTGTGTGCTCAGATGATGATCACAGGTTCAAAACCTTGGAGAACCAAAAGAAGCCCATCTTTCTGAAAGGGTTGAAGAAAATATGGGAAAACAAGGATTTCAAAGCCTCACTTCCATCTTCCATGGGGAAATACTCTTCATTGAACACCTTGTTAATTGATGATAAGGCTTACAAGGCTCTACTAAATCCTGCTCACACAGCCATCTTTCCTCCTGAATTCAAGGTTGACCAAGTTGATGACAAGGCTTTAGGTCCTAATGGTGAGTTGAGGCTTTACTTGGAGGGACTTGCAGATGCCGATGATGTTACTTCTTATGTTAAAGATCATCCATTTGGACAGCCAGCAATAACAACTACTCACTCAGATTGGGATTTCTATTCAAAGATCCTTACTCATTTCCAGAAAGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

145

Amino Acids

16.48

Weight (kDa)

6.51

Isoelectric Point (pI)

13.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 406
AcsI RAATTY 1 cut(s) 242
AgsI TTSAA 6 cut(s) 55, 100, 127, 169, 247, 408
Alw21I GWGCWC 1 cut(s) 35
AlwI GGATC 1 cut(s) 406
ApoI RAATTY 1 cut(s) 242
AspS9I GGNCC 1 cut(s) 278
AsuHPI GGTGA 1 cut(s) 299
AvaII GGWCC 1 cut(s) 278
Bbv12I GWGCWC 1 cut(s) 35
BccI CCATC 3 cut(s) 89, 148, 236
BclI TGATCA 1 cut(s) 43
Bme18I GGWCC 1 cut(s) 278
BmgT120I GGNCC 1 cut(s) 278
BmsI GCATC 1 cut(s) 310
BsaBI GATNNNNATC 1 cut(s) 42
BsaJI CCNNGG 2 cut(s) 60, 147
Bse8I GATNNNNATC 1 cut(s) 42
BseDI CCNNGG 2 cut(s) 60, 147
BseGI GGATG 1 cut(s) 352
BseJI GATNNNNATC 1 cut(s) 42
BseMII CTCAG 2 cut(s) 48, 402
BsiHKAI GWGCWC 1 cut(s) 35
BslFI GGGAC 1 cut(s) 324
BsmFI GGGAC 1 cut(s) 324
Bsp1286I GDGCHC 1 cut(s) 35
Bsp143I GATC 3 cut(s) 43, 349, 411
Bsp19I CCATGG 1 cut(s) 147
BspCNI CTCAG 2 cut(s) 47, 401
BspPI GGATC 1 cut(s) 406
BssECI CCNNGG 2 cut(s) 60, 147
BssMI GATC 3 cut(s) 43, 349, 411
BssT1I CCWWGG 2 cut(s) 60, 147
Bst6I CTCTTC 1 cut(s) 166
BstC8I GCNNGC 1 cut(s) 369
BstDEI CTNAG 2 cut(s) 34, 388
BstDSI CCRYGG 1 cut(s) 147
BstF5I GGATG 1 cut(s) 352
BstKTI GATC 3 cut(s) 46, 352, 414
BstMBI GATC 3 cut(s) 43, 349, 411
BstMWI GCNNNNNNNGC 2 cut(s) 200, 224
BstX2I RGATCY 1 cut(s) 411
BstYI RGATCY 1 cut(s) 411
BtgI CCRYGG 1 cut(s) 147
BtsCI GGATG 1 cut(s) 352
Cac8I GCNNGC 1 cut(s) 369
Cfr13I GGNCC 1 cut(s) 278
CviAII CATG 1 cut(s) 148
CviJI RGCY 9 cut(s) 5, 79, 131, 194, 203, 227, 272, 298, 367
CviKI_1 RGCY 9 cut(s) 5, 79, 131, 194, 203, 227, 272, 298, 367
DdeI CTNAG 2 cut(s) 34, 388
DpnI GATC 3 cut(s) 45, 351, 413
DpnII GATC 3 cut(s) 43, 349, 411
Eam1104I CTCTTC 1 cut(s) 166
EarI CTCTTC 1 cut(s) 166
Eco130I CCWWGG 2 cut(s) 60, 147
Eco47I GGWCC 1 cut(s) 278
EcoO109I RGGNCCY 1 cut(s) 278
EcoRI GAATTC 1 cut(s) 242
EcoT14I CCWWGG 2 cut(s) 60, 147
ErhI CCWWGG 2 cut(s) 60, 147
FaeI CATG 1 cut(s) 151
FaiI YATR 3 cut(s) 109, 149, 342
FalI AAGNNNNNCTT 4 cut(s) 68, 100, 120, 152
FaqI GGGAC 1 cut(s) 324
FatI CATG 1 cut(s) 147
FbaI TGATCA 1 cut(s) 43
FokI GGATG 1 cut(s) 339
Hin1II CATG 1 cut(s) 151
HincII GTYRAC 1 cut(s) 253
HindII GTYRAC 1 cut(s) 253
HphI GGTGA 1 cut(s) 299
Hpy166II GTNNAC 1 cut(s) 253
Hpy188I TCNGA 3 cut(s) 37, 90, 391
Hpy188III TCNNGA 2 cut(s) 239, 427
Hpy8I GTNNAC 1 cut(s) 253
HpyCH4V TGCA 1 cut(s) 317
HpyF10VI GCNNNNNNNGC 2 cut(s) 200, 224
HpyF3I CTNAG 2 cut(s) 34, 388
Hsp92II CATG 1 cut(s) 151
Ksp22I TGATCA 1 cut(s) 43
Kzo9I GATC 3 cut(s) 43, 349, 411
LpnPI CCDG 4 cut(s) 34, 228, 252, 381
LweI GCATC 1 cut(s) 310
MaeIII GTNAC 1 cut(s) 331
MalI GATC 3 cut(s) 45, 351, 413
MboI GATC 3 cut(s) 43, 349, 411
MboII GAAGA 3 cut(s) 112, 135, 153
MflI RGATCY 1 cut(s) 411
MhlI GDGCHC 1 cut(s) 35
MluCI AATT 2 cut(s) 180, 242
MnlI CCTC 4 cut(s) 142, 246, 288, 301
MseI TTAA 3 cut(s) 179, 345, 436
MwoI GCNNNNNNNGC 2 cut(s) 200, 224
NcoI CCATGG 1 cut(s) 147
NdeII GATC 3 cut(s) 43, 349, 411
NlaIII CATG 1 cut(s) 151
PpuMI RGGWCCY 1 cut(s) 278
Psp5II RGGWCCY 1 cut(s) 278
PspPI GGNCC 1 cut(s) 278
PspPPI RGGWCCY 1 cut(s) 278
PsuI RGATCY 1 cut(s) 411
SaqAI TTAA 3 cut(s) 179, 345, 436
Sau3AI GATC 3 cut(s) 43, 349, 411
Sau96I GGNCC 1 cut(s) 278
SduI GDGCHC 1 cut(s) 35
SetI ASST 5 cut(s) 53, 62, 176, 252, 280
SfaNI GCATC 1 cut(s) 310
SinI GGWCC 1 cut(s) 278
Sse9I AATT 2 cut(s) 180, 242
StyI CCWWGG 2 cut(s) 60, 147
TasI AATT 2 cut(s) 180, 242
Tru1I TTAA 3 cut(s) 179, 345, 436
Tru9I TTAA 3 cut(s) 179, 345, 436
TspDTI ATGAA 1 cut(s) 153
VpaK11BI GGWCC 1 cut(s) 278
XapI RAATTY 1 cut(s) 242
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.