Rh3AG172400

NLI interacting factor-like phosphatase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
OG0000875
Physical Location & Seq
Reverse (-)
16007867 .. 16008304
438 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG172400.1

Sequence Viewer

Length: 213 bp
ATGGGATACTTTGTTGATTATGATCAACCTTACAAGACTCTACTCAATCCTGCTCACATAGGGATTTTTCTGGAATCCTACAATCCTGACCTTGCTAGTGATAATTTATTGGTTAGGGTTGTATTTGGATGGCCTTGCGGCTGCGACCAATGCTCAAGTTTATGTGAAGGAGAACCCTATTGGACTGCCTGCAATTTCAACAGACCATCCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
NIF

Protein Analysis

70

Amino Acids

7.94

Weight (kDa)

4.23

Isoelectric Point (pI)

32.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 138
AgsI TTSAA 1 cut(s) 199
AoxI GGCC 1 cut(s) 131
ApeKI GCWGC 1 cut(s) 141
BbvI GCAGC 1 cut(s) 128
BccI CCATC 1 cut(s) 123
BclI TGATCA 1 cut(s) 22
BfaI CTAG 1 cut(s) 96
BisI GCNGC 2 cut(s) 139, 142
BlsI GCNGC 2 cut(s) 140, 143
BpuEI CTTGAG 1 cut(s) 139
BsaBI GATNNNNATC 1 cut(s) 21
Bse8I GATNNNNATC 1 cut(s) 21
BseGI GGATG 2 cut(s) 134, 206
BseJI GATNNNNATC 1 cut(s) 21
BseXI GCAGC 1 cut(s) 128
BshFI GGCC 1 cut(s) 133
BsnI GGCC 1 cut(s) 133
Bsp143I GATC 1 cut(s) 22
BspACI CCGC 1 cut(s) 138
BspANI GGCC 1 cut(s) 133
BssMI GATC 1 cut(s) 22
BstC8I GCNNGC 1 cut(s) 190
BstF5I GGATG 2 cut(s) 134, 206
BstKTI GATC 1 cut(s) 25
BstMBI GATC 1 cut(s) 22
BstMWI GCNNNNNNNGC 1 cut(s) 150
BstV1I GCAGC 1 cut(s) 128
BsuRI GGCC 1 cut(s) 133
BtsCI GGATG 2 cut(s) 134, 206
Cac8I GCNNGC 1 cut(s) 190
CviJI RGCY 2 cut(s) 133, 141
CviKI_1 RGCY 2 cut(s) 133, 141
DpnI GATC 1 cut(s) 24
DpnII GATC 1 cut(s) 22
FaiI YATR 3 cut(s) 21, 59, 163
FbaI TGATCA 1 cut(s) 22
Fnu4HI GCNGC 2 cut(s) 139, 142
FokI GGATG 2 cut(s) 141, 193
Fsp4HI GCNGC 2 cut(s) 139, 142
FspBI CTAG 1 cut(s) 96
GluI GCNGC 2 cut(s) 139, 142
HaeIII GGCC 1 cut(s) 133
HinfI GANTC 2 cut(s) 37, 74
Hpy188III TCNNGA 3 cut(s) 71, 86, 210
HpyAV CCTTC 1 cut(s) 161
HpyCH4V TGCA 1 cut(s) 192
HpyF10VI GCNNNNNNNGC 1 cut(s) 150
Ksp22I TGATCA 1 cut(s) 22
Kzo9I GATC 1 cut(s) 22
LpnPI CCDG 4 cut(s) 56, 63, 99, 202
Lsp1109I GCAGC 1 cut(s) 128
MaeI CTAG 1 cut(s) 96
MalI GATC 1 cut(s) 24
MboI GATC 1 cut(s) 22
MluCI AATT 2 cut(s) 103, 193
MlyI GAGTC 1 cut(s) 31
MwoI GCNNNNNNNGC 1 cut(s) 150
NdeII GATC 1 cut(s) 22
PfeI GAWTC 1 cut(s) 74
PkrI GCNGC 2 cut(s) 140, 143
PleI GAGTC 1 cut(s) 31
PpsI GAGTC 1 cut(s) 31
SatI GCNGC 2 cut(s) 139, 142
Sau3AI GATC 1 cut(s) 22
SchI GAGTC 1 cut(s) 31
SetI ASST 2 cut(s) 31, 93
SgeI CNNG 9 cut(s) 46, 62, 83, 98, 104, 108, 147, 168, 201
SmlI CTYRAG 1 cut(s) 154
SmoI CTYRAG 1 cut(s) 154
Sse9I AATT 2 cut(s) 103, 193
SsiI CCGC 1 cut(s) 138
SspMI CTAG 1 cut(s) 96
TasI AATT 2 cut(s) 103, 193
TauI GCSGC 1 cut(s) 141
TfiI GAWTC 1 cut(s) 74
TseI GCWGC 1 cut(s) 141
XspI CTAG 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.