Rh3AG176200

NLI interacting factor-like phosphatase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Forward (+)
16426395 .. 16427174
780 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG176200.1

Sequence Viewer

Length: 552 bp
ATGGTACTTGGACAATGCCTTGGATTGTGGGATGAAAGGATTGAGGAGGAAGTTGTTGTTTGCTTGGGTACATACACAATATCTCATGTCATGCACTTTAAATTTTGTAAAGCTTTGGTTCATTGTTTTGACATTGATGATCAAGTGGAGTGTACTGATTCAGGGTTCAAAACCTTGGAGAACCAAAAGAAGCCCATCTTTCTGAAAGGGTTGAAGAAAATATGGGAAAACAAGGATTTCAAAGCCTCACTTCCATCTTCCATGGGGAAATACTCTTCATTGAACACCTTGTTAATTGATGATAAGGCTTACAAGGCTCTACTAAATCCTGCTCACACAGCCATCTTTCCTCCTGAATTCAAGGTTGACCAAGTTGATGACAAGGCTTTAGGTCCTAATGGTGAGTTGAGGCTTTACTTGGAGGGACTTGCAGATGCCGATGATGTTACTTCTTATGTTAAAGATCATCCATTTGGACAGCCAGCAATAACAACTACTCACTCAGATTGGGATTTCTATTCAAAGATCCTTACTCATTTCCAGAAAGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

183

Amino Acids

20.78

Weight (kDa)

5.32

Isoelectric Point (pI)

26.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 520
AcsI RAATTY 2 cut(s) 101, 356
AfaI GTAC 3 cut(s) 6, 70, 154
AgsI TTSAA 6 cut(s) 169, 214, 241, 283, 361, 522
AluBI AGCT 1 cut(s) 113
AluI AGCT 1 cut(s) 113
AlwI GGATC 1 cut(s) 520
ApoI RAATTY 2 cut(s) 101, 356
AspS9I GGNCC 1 cut(s) 392
AsuHPI GGTGA 1 cut(s) 413
AvaII GGWCC 1 cut(s) 392
BccI CCATC 3 cut(s) 203, 262, 350
BclI TGATCA 1 cut(s) 139
Bme18I GGWCC 1 cut(s) 392
BmgT120I GGNCC 1 cut(s) 392
BmsI GCATC 1 cut(s) 424
BsaJI CCNNGG 3 cut(s) 19, 174, 261
BseDI CCNNGG 3 cut(s) 19, 174, 261
BseGI GGATG 2 cut(s) 37, 466
BseMII CTCAG 1 cut(s) 516
BseRI GAGGAG 1 cut(s) 59
BslFI GGGAC 1 cut(s) 438
BsmFI GGGAC 1 cut(s) 438
Bsp143I GATC 3 cut(s) 139, 463, 525
Bsp19I CCATGG 1 cut(s) 261
BspCNI CTCAG 1 cut(s) 515
BspPI GGATC 1 cut(s) 520
BssECI CCNNGG 3 cut(s) 19, 174, 261
BssMI GATC 3 cut(s) 139, 463, 525
BssT1I CCWWGG 3 cut(s) 19, 174, 261
Bst6I CTCTTC 1 cut(s) 280
BstC8I GCNNGC 1 cut(s) 483
BstDEI CTNAG 1 cut(s) 502
BstDSI CCRYGG 1 cut(s) 261
BstF5I GGATG 2 cut(s) 37, 466
BstKTI GATC 3 cut(s) 142, 466, 528
BstMBI GATC 3 cut(s) 139, 463, 525
BstMWI GCNNNNNNNGC 2 cut(s) 314, 338
BstX2I RGATCY 1 cut(s) 525
BstYI RGATCY 1 cut(s) 525
BtgI CCRYGG 1 cut(s) 261
BtsCI GGATG 2 cut(s) 37, 466
Cac8I GCNNGC 1 cut(s) 483
Cfr13I GGNCC 1 cut(s) 392
Csp6I GTAC 3 cut(s) 5, 69, 153
CviAII CATG 3 cut(s) 86, 91, 262
CviJI RGCY 9 cut(s) 113, 193, 245, 308, 317, 341, 386, 412, 481
CviKI_1 RGCY 9 cut(s) 113, 193, 245, 308, 317, 341, 386, 412, 481
CviQI GTAC 3 cut(s) 5, 69, 153
DdeI CTNAG 1 cut(s) 502
DpnI GATC 3 cut(s) 141, 465, 527
DpnII GATC 3 cut(s) 139, 463, 525
DraI TTTAAA 1 cut(s) 100
Eam1104I CTCTTC 1 cut(s) 280
EarI CTCTTC 1 cut(s) 280
Eco130I CCWWGG 3 cut(s) 19, 174, 261
Eco47I GGWCC 1 cut(s) 392
EcoO109I RGGNCCY 1 cut(s) 392
EcoRI GAATTC 1 cut(s) 356
EcoT14I CCWWGG 3 cut(s) 19, 174, 261
ErhI CCWWGG 3 cut(s) 19, 174, 261
FaeI CATG 3 cut(s) 89, 94, 265
FaiI YATR 6 cut(s) 73, 87, 92, 223, 263, 456
FalI AAGNNNNNCTT 4 cut(s) 182, 214, 234, 266
FaqI GGGAC 1 cut(s) 438
FatI CATG 3 cut(s) 85, 90, 261
FbaI TGATCA 1 cut(s) 139
FokI GGATG 2 cut(s) 44, 453
Hin1II CATG 3 cut(s) 89, 94, 265
HincII GTYRAC 1 cut(s) 367
HindII GTYRAC 1 cut(s) 367
HindIII AAGCTT 1 cut(s) 111
HinfI GANTC 1 cut(s) 158
HphI GGTGA 1 cut(s) 413
Hpy166II GTNNAC 2 cut(s) 153, 367
Hpy188I TCNGA 2 cut(s) 204, 505
Hpy188III TCNNGA 2 cut(s) 353, 541
Hpy8I GTNNAC 2 cut(s) 153, 367
HpyCH4V TGCA 2 cut(s) 94, 431
HpyF10VI GCNNNNNNNGC 2 cut(s) 314, 338
HpyF3I CTNAG 1 cut(s) 502
Hsp92II CATG 3 cut(s) 89, 94, 265
Ksp22I TGATCA 1 cut(s) 139
Kzo9I GATC 3 cut(s) 139, 463, 525
LpnPI CCDG 4 cut(s) 147, 342, 366, 495
LweI GCATC 1 cut(s) 424
MaeIII GTNAC 1 cut(s) 445
MalI GATC 3 cut(s) 141, 465, 527
MboI GATC 3 cut(s) 139, 463, 525
MboII GAAGA 3 cut(s) 226, 249, 267
MflI RGATCY 1 cut(s) 525
MluCI AATT 3 cut(s) 101, 294, 356
MnlI CCTC 6 cut(s) 37, 40, 256, 360, 402, 415
MseI TTAA 4 cut(s) 99, 293, 459, 550
MwoI GCNNNNNNNGC 2 cut(s) 314, 338
NcoI CCATGG 1 cut(s) 261
NdeII GATC 3 cut(s) 139, 463, 525
NlaIII CATG 3 cut(s) 89, 94, 265
PfeI GAWTC 1 cut(s) 158
PpuMI RGGWCCY 1 cut(s) 392
Psp5II RGGWCCY 1 cut(s) 392
PspPI GGNCC 1 cut(s) 392
PspPPI RGGWCCY 1 cut(s) 392
PsuI RGATCY 1 cut(s) 525
RsaI GTAC 3 cut(s) 6, 70, 154
RsaNI GTAC 3 cut(s) 5, 69, 153
SaqAI TTAA 4 cut(s) 99, 293, 459, 550
Sau3AI GATC 3 cut(s) 139, 463, 525
Sau96I GGNCC 1 cut(s) 392
SetI ASST 5 cut(s) 115, 176, 290, 366, 394
SfaNI GCATC 1 cut(s) 424
SinI GGWCC 1 cut(s) 392
Sse9I AATT 3 cut(s) 101, 294, 356
StyI CCWWGG 3 cut(s) 19, 174, 261
TasI AATT 3 cut(s) 101, 294, 356
TatI WGTACW 1 cut(s) 152
TfiI GAWTC 1 cut(s) 158
Tru1I TTAA 4 cut(s) 99, 293, 459, 550
Tru9I TTAA 4 cut(s) 99, 293, 459, 550
TspDTI ATGAA 3 cut(s) 48, 110, 267
VpaK11BI GGWCC 1 cut(s) 392
XapI RAATTY 2 cut(s) 101, 356
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.