Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0000875

Physical Location & Seq

Genomic Coordinates Reverse (-)

17776888 .. 17777793

Gene Structure 906 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ43762

Sequence Viewer

CDS Protein Promoter (2k)

Length: 531 bp

ATGGGGATGATGATGCATGGTGACTATGATAGTGTTTCCTGTCGCAGTGATGGCAATGACTGCGATAACGAAGACACTGGAAGCCATTGTGGCCTTTCACTACAGAAGCTGAATTTAGGACCAAGAAAGAAGCTTCTTGTTTTCAATCTCCATGGGTGTTTAATCAACAGGGTTTACCGGCACGACAGTCAGGCCAGAATTCCAAGTGATCGTAGTCCTGATGGCAGATATGGAAATCATCTAGTTTTTAAAAGACCTTTTGCAGAGGGGTTCATGCAATTCTGTTTTGAAAGATTTGAAATTGGCAATATAGTCTTCTGCCCAAGAGAAAATGTTGATGATATCTCGGAGTGTATGATGGGAAGACTGAGAAACAGGCTGTCATTTGATCAAGTTGAATGCACTGAAACCGGGTTCAAGTTGGTAGAGAATAGATCGAAGCCCTTGTTTCTTAAAGAACTGAAGGAATTGTGGAAATATCTTGATTGGCAGTATTCTGAATCCGACACACTGTTGATTGATGGTAAGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NIF

Protein Analysis

176

Amino Acids

20.46

Weight (kDa)

5.96

Isoelectric Point (pI)

44.58

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000875)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G36540 AT2G36550
fragaria_vesca	FvH4_6g17650 FvH4_6g17650 FvH4_6g17680 FvH4_6g18040 FvH4_6g18040 FvH4_6g18041
malus_domestica	MD14G1013900.v1.1 MD14G1014000.v1.1 MD14G1014100.v1.1
prunus_persica	Prupe.7G119400_v2.0.a1 Prupe.7G119500_v2.0.a1 Prupe.7G119500_v2.0.a1
pyrus_communis	pycom14g01180 pycom14g01190
rosa_chinensis	RchiOBHm_Chr3g0471881 RchiOBHm_Chr3g0471901 RchiOBHm_Chr3g0472301 RchiOBHm_Chr3g0472311 RchiOBHm_Chr4g0442541
rosa_laevigata	RLG00000006003 RLG00000024088 RLG00000024089 RLG00000024121
rosa_multiflora	Rmu_sc0000627.1_g000001 Rmu_sc0002115.1_g000024 Rmu_sc0016565.1_g000001 Rmu_sc0036882.1_g000001 Rmu_ssc0000204.1_g000046
rosa_roxburghii	Rroxscaffold_5G00383360 Rroxscaffold_6G00409040 Rroxscaffold_6G00409080 Rroxscaffold_6G00409090 Rroxscaffold_6G00409430 Rroxscaffold_6G00409450 Rroxscaffold_6G00410650
rosa_rugosa	Rorug03G0111000 Rorug03G0111100 Rorug03G0121100 Rorug03G0123800 Rorug03G0123900 Rorug03G0124100 Rorug04G0341200
rosa_samantha	Rh3AG172300 Rh3AG172400 Rh3AG172500 Rh3AG176100 Rh3AG176200 Rh3BG197800 Rh3BG197900 Rh3BG201800 Rh3BG201900 Rh3CG188800 Rh3DG173400 Rh3DG173500 Rh3DG176400 Rh3DG176600 Rh4AG393500 Rh4BG406600 Rh4CG422000
rosa_wichuraiana	Rw3G015210 Rw3G016510 Rw3G016520 Rw3G016820 Rw4G034000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	2 cut(s)	112, 198
AcuI	CTGAAG	1 cut(s)	482
AgsI	TTSAA	5 cut(s)	145, 290, 299, 398, 418
AluBI	AGCT	2 cut(s)	109, 133
AluI	AGCT	2 cut(s)	109, 133
AlwNI	CAGNNNCTG	1 cut(s)	109
AoxI	GGCC	2 cut(s)	91, 192
ApoI	RAATTY	2 cut(s)	112, 198
AspS9I	GGNCC	1 cut(s)	119
AsuC2I	CCSGG	1 cut(s)	412
AsuHPI	GGTGA	1 cut(s)	32
AvaII	GGWCC	1 cut(s)	119
BbsI	GAAGAC	3 cut(s)	78, 307, 370
BccI	CCATC	4 cut(s)	44, 215, 352, 515
BclI	TGATCA	1 cut(s)	388
BcnI	CCSGG	1 cut(s)	412
BfaI	CTAG	1 cut(s)	242
BfmI	CTRYAG	1 cut(s)	101
BglI	GCCNNNNNGGC	1 cut(s)	90
Bme1390I	CCNGG	1 cut(s)	412
Bme18I	GGWCC	1 cut(s)	119
BmgT120I	GGNCC	1 cut(s)	119
BmrFI	CCNGG	1 cut(s)	412
BmsI	GCATC	1 cut(s)	3
BpiI	GAAGAC	3 cut(s)	78, 307, 370
BpuMI	CCSGG	1 cut(s)	412
BsaJI	CCNNGG	1 cut(s)	151
Bse118I	RCCGGY	1 cut(s)	177
Bse1I	ACTGG	1 cut(s)	82
Bse3DI	GCAATG	1 cut(s)	61
BseDI	CCNNGG	1 cut(s)	151
BseGI	GGATG	1 cut(s)	12
BseMI	GCAATG	1 cut(s)	61
BseMII	CTCAG	1 cut(s)	359
BseNI	ACTGG	1 cut(s)	82
BshFI	GGCC	2 cut(s)	93, 194
BsiSI	CCGG	2 cut(s)	178, 411
BsmI	GAATGC	1 cut(s)	404
BsnI	GGCC	2 cut(s)	93, 194
Bsp143I	GATC	3 cut(s)	208, 388, 434
Bsp19I	CCATGG	1 cut(s)	151
BspANI	GGCC	2 cut(s)	93, 194
BspCNI	CTCAG	1 cut(s)	360
BsrDI	GCAATG	1 cut(s)	61
BsrFI	RCCGGY	1 cut(s)	177
BsrI	ACTGG	1 cut(s)	82
BssAI	RCCGGY	1 cut(s)	177
BssECI	CCNNGG	1 cut(s)	151
BssMI	GATC	3 cut(s)	208, 388, 434
BssT1I	CCWWGG	1 cut(s)	151
Bst4CI	ACNGT	2 cut(s)	188, 513
BstAPI	GCANNNNNTGC	1 cut(s)	60
BstDEI	CTNAG	1 cut(s)	368
BstDSI	CCRYGG	1 cut(s)	151
BstF5I	GGATG	1 cut(s)	12
BstKTI	GATC	3 cut(s)	211, 391, 437
BstMBI	GATC	3 cut(s)	208, 388, 434
BstMWI	GCNNNNNNNGC	3 cut(s)	51, 60, 90
BstSCI	CCNGG	1 cut(s)	410
BstSFI	CTRYAG	1 cut(s)	101
BstV2I	GAAGAC	3 cut(s)	78, 307, 370
BsuRI	GGCC	2 cut(s)	93, 194
BtgI	CCRYGG	1 cut(s)	151
BtsCI	GGATG	1 cut(s)	12
BtsI	GCAGTG	1 cut(s)	52
BtsIMutI	CAGTG	4 cut(s)	52, 75, 402, 509
CaiI	CAGNNNCTG	1 cut(s)	109
Cfr10I	RCCGGY	1 cut(s)	177
Cfr13I	GGNCC	1 cut(s)	119
CviAII	CATG	3 cut(s)	17, 152, 274
CviJI	RGCY	7 cut(s)	84, 93, 109, 133, 194, 379, 442
CviKI_1	RGCY	7 cut(s)	84, 93, 109, 133, 194, 379, 442
DdeI	CTNAG	1 cut(s)	368
DpnI	GATC	3 cut(s)	210, 390, 436
DpnII	GATC	3 cut(s)	208, 388, 434
DraI	TTTAAA	1 cut(s)	250
Eco130I	CCWWGG	1 cut(s)	151
Eco32I	GATATC	1 cut(s)	343
Eco47I	GGWCC	1 cut(s)	119
Eco57I	CTGAAG	1 cut(s)	482
EcoRI	GAATTC	1 cut(s)	198
EcoRV	GATATC	1 cut(s)	343
EcoT14I	CCWWGG	1 cut(s)	151
EcoT22I	ATGCAT	1 cut(s)	18
ErhI	CCWWGG	1 cut(s)	151
FaeI	CATG	3 cut(s)	20, 155, 277
FaiI	YATR	7 cut(s)	18, 27, 153, 231, 275, 311, 356
FatI	CATG	3 cut(s)	16, 151, 273
FbaI	TGATCA	1 cut(s)	388
FokI	GGATG	1 cut(s)	19
FspBI	CTAG	1 cut(s)	242
HaeIII	GGCC	2 cut(s)	93, 194
HapII	CCGG	2 cut(s)	178, 411
Hin1II	CATG	3 cut(s)	20, 155, 277
HindIII	AAGCTT	1 cut(s)	131
HinfI	GANTC	1 cut(s)	500
HpaII	CCGG	2 cut(s)	178, 411
HphI	GGTGA	1 cut(s)	32
Hpy166II	GTNNAC	1 cut(s)	175
Hpy188I	TCNGA	3 cut(s)	349, 499, 505
Hpy188III	TCNNGA	2 cut(s)	218, 482
Hpy8I	GTNNAC	1 cut(s)	175
HpyAV	CCTTC	1 cut(s)	457
HpyCH4III	ACNGT	2 cut(s)	188, 513
HpyCH4V	TGCA	4 cut(s)	16, 263, 277, 402
HpyF10VI	GCNNNNNNNGC	3 cut(s)	51, 60, 90
HpyF3I	CTNAG	1 cut(s)	368
Hsp92II	CATG	3 cut(s)	20, 155, 277
Ksp22I	TGATCA	1 cut(s)	388
Kzo9I	GATC	3 cut(s)	208, 388, 434
LpnPI	CCDG	9 cut(s)	52, 63, 154, 176, 191, 208, 231, 361, 424
LweI	GCATC	1 cut(s)	3
MaeI	CTAG	1 cut(s)	242
MaeIII	GTNAC	1 cut(s)	20
MalI	GATC	3 cut(s)	210, 390, 436
MboI	GATC	3 cut(s)	208, 388, 434
MboII	GAAGA	3 cut(s)	83, 307, 375
MluCI	AATT	5 cut(s)	112, 198, 278, 300, 467
MmeI	TCCRAC	1 cut(s)	528
MnlI	CCTC	1 cut(s)	259
Mph1103I	ATGCAT	1 cut(s)	18
MseI	TTAA	3 cut(s)	161, 249, 453
MspI	CCGG	2 cut(s)	178, 411
MspR9I	CCNGG	1 cut(s)	412
Mva1269I	GAATGC	1 cut(s)	404
MwoI	GCNNNNNNNGC	3 cut(s)	51, 60, 90
NciI	CCSGG	1 cut(s)	412
NcoI	CCATGG	1 cut(s)	151
NdeII	GATC	3 cut(s)	208, 388, 434
NlaIII	CATG	3 cut(s)	20, 155, 277
NmuCI	GTSAC	1 cut(s)	20
NsiI	ATGCAT	1 cut(s)	18
PctI	GAATGC	1 cut(s)	404
PfeI	GAWTC	1 cut(s)	500
PspPI	GGNCC	1 cut(s)	119
PstNI	CAGNNNCTG	1 cut(s)	109
SaqAI	TTAA	3 cut(s)	161, 249, 453
Sau3AI	GATC	3 cut(s)	208, 388, 434
Sau96I	GGNCC	1 cut(s)	119
ScrFI	CCNGG	1 cut(s)	412
SetI	ASST	3 cut(s)	111, 135, 259
SfaNI	GCATC	1 cut(s)	3
SfcI	CTRYAG	1 cut(s)	101
SinI	GGWCC	1 cut(s)	119
Sse9I	AATT	5 cut(s)	112, 198, 278, 300, 467
SspMI	CTAG	1 cut(s)	242
StyD4I	CCNGG	1 cut(s)	410
StyI	CCWWGG	1 cut(s)	151
TaaI	ACNGT	2 cut(s)	188, 513
TaqI	TCGA	1 cut(s)	437
TasI	AATT	5 cut(s)	112, 198, 278, 300, 467
TfiI	GAWTC	1 cut(s)	500
Tru1I	TTAA	3 cut(s)	161, 249, 453
Tru9I	TTAA	3 cut(s)	161, 249, 453
TscAI	CASTG	4 cut(s)	52, 82, 409, 516
TseFI	GTSAC	1 cut(s)	20
Tsp45I	GTSAC	1 cut(s)	20
TspDTI	ATGAA	1 cut(s)	262
TspRI	CASTG	4 cut(s)	52, 82, 409, 516
VpaK11BI	GGWCC	1 cut(s)	119
XapI	RAATTY	2 cut(s)	112, 198
XspI	CTAG	1 cut(s)	242
Zsp2I	ATGCAT	1 cut(s)	18

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.