MD10G1100200.v1.1

Belongs to the cyclin family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
Physical Location & Seq
Reverse (-)
16186652 .. 16187548
897 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1100200.v1.1.491

Sequence Viewer

Length: 159 bp
ATGTGTGTCCTTGCTATTCATGACCTGCAGTTGAACAGAAAATCAAGCTCTCTGCAAGCGATAAGAGAAAAATACATGAGACCAAAGAATAAGAGCGTGGCGAAACTGTCTTCGCTCTCTGAAATTCCTGCAACTTATTTTGAGGCCATCTACCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

53

Amino Acids

5.94

Weight (kDa)

9.58

Isoelectric Point (pI)

60.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cyclin_C PF02984 2 - 38 7.3e-06 Cyclin, C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000541)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G47210 AT1G47210 AT1G47220 AT1G47230 AT1G47230 AT2G01310 AT5G43080 AT5G43080
fragaria_vesca FvH4_2g04770 FvH4_2g04770 FvH4_2g04770 FvH4_2g33510 FvH4_2g33510 FvH4_2g33510 FvH4_2g33511 FvH4_2g33511 FvH4_2g33511 FvH4_2g33511 FvH4_2g33530 FvH4_2g33530
malus_domestica MD05G1092000.v1.1 MD08G1091000.v1.1 MD08G1091200.v1.1 MD10G1100200.v1.1 MD10G1100700.v1.1 MD12G1105600.v1.1 MD15G1075100.v1.1 MD15G1075200.v1.1
prunus_persica Prupe.1G428000_v2.0.a1 Prupe.1G428100_v2.0.a1 Prupe.4G285800_v2.0.a1 Prupe.8G137700_v2.0.a1 Prupe.8G137700_v2.0.a1
pyrus_communis pycom05g09170 pycom08g07360 pycom08g07370 pycom15g07000 pycom15g07020
rosa_chinensis RchiOBHm_Chr3g0465621 RchiOBHm_Chr6g0254421 RchiOBHm_Chr6g0254451 RchiOBHm_Chr6g0308961 RchiOBHm_Chr6g0308971 RchiOBHm_Chr6g0308991 RchiOBHm_Chr7g0190851
rosa_laevigata RLG00000003915 RLG00000010598 RLG00000010599 RLG00000010600 RLG00000014913
rosa_multiflora Rmu_sc0009578.1_g000002 Rmu_sc0009578.1_g000003 Rmu_sc0029942.1_g000001 Rmu_sc0036151.1_g000001 Rmu_sc0036151.1_g000002 Rmu_sc0037719.1_g000001 Rmu_sc0042877.1_g000001 Rmu_ssc0000481.1_g000003
rosa_roxburghii Rroxscaffold_7G00159740 Rroxscaffold_7G00159750 Rroxscaffold_7G00159760 Rroxscaffold_7G00159770 Rroxscaffold_7G00210810
rosa_rugosa Rorug05G0552200 Rorug05G0552300 Rorug05G0552400
rosa_samantha Rh3CG081000 Rh6AG069300 Rh6AG481300 Rh6AG481600 Rh6BG062000 Rh6BG490400 Rh6BG490500 Rh6BG490600 Rh6CG062100 Rh6CG495700 Rh6CG495900 Rh6DG059100 Rh6DG481600 Rh6DG481700 Rh6DG481800
rosa_wichuraiana Rw6G006090 Rw6G041930 Rw6G041940

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 33
AcsI RAATTY 1 cut(s) 123
AgsI TTSAA 1 cut(s) 34
AluBI AGCT 1 cut(s) 48
AluI AGCT 1 cut(s) 48
Alw26I GTCTC 1 cut(s) 73
AoxI GGCC 1 cut(s) 144
ApoI RAATTY 1 cut(s) 123
BbsI GAAGAC 1 cut(s) 102
BccI CCATC 1 cut(s) 155
BcoDI GTCTC 1 cut(s) 73
BfmI CTRYAG 1 cut(s) 26
BfuAI ACCTGC 1 cut(s) 33
BpiI GAAGAC 1 cut(s) 102
BsaI GGTCTC 1 cut(s) 73
BshFI GGCC 1 cut(s) 146
BsmAI GTCTC 1 cut(s) 73
BsnI GGCC 1 cut(s) 146
Bso31I GGTCTC 1 cut(s) 73
BspANI GGCC 1 cut(s) 146
BspHI TCATGA 1 cut(s) 19
BspMAI CTGCAG 1 cut(s) 30
BspMI ACCTGC 1 cut(s) 33
BspTNI GGTCTC 1 cut(s) 73
Bst4CI ACNGT 1 cut(s) 108
BstC8I GCNNGC 1 cut(s) 57
BstMAI GTCTC 1 cut(s) 73
BstSFI CTRYAG 1 cut(s) 26
BstV2I GAAGAC 1 cut(s) 102
BsuRI GGCC 1 cut(s) 146
BveI ACCTGC 1 cut(s) 33
Cac8I GCNNGC 1 cut(s) 57
CciI TCATGA 1 cut(s) 19
CviAII CATG 3 cut(s) 20, 76, 156
CviJI RGCY 2 cut(s) 48, 146
CviKI_1 RGCY 2 cut(s) 48, 146
Eco31I GGTCTC 1 cut(s) 73
FaeI CATG 3 cut(s) 23, 79, 159
FaiI YATR 3 cut(s) 21, 77, 157
FatI CATG 3 cut(s) 19, 75, 155
FspEI CC 6 cut(s) 23, 38, 83, 96, 128, 141
HaeIII GGCC 1 cut(s) 146
Hin1II CATG 3 cut(s) 23, 79, 159
Hpy188I TCNGA 1 cut(s) 121
Hpy188III TCNNGA 1 cut(s) 20
HpyCH4III ACNGT 1 cut(s) 108
HpyCH4V TGCA 3 cut(s) 28, 55, 131
Hsp92II CATG 3 cut(s) 23, 79, 159
LpnPI CCDG 2 cut(s) 38, 141
MboII GAAGA 1 cut(s) 102
MluCI AATT 1 cut(s) 123
MnlI CCTC 1 cut(s) 136
NlaIII CATG 3 cut(s) 23, 79, 159
PagI TCATGA 1 cut(s) 19
PstI CTGCAG 1 cut(s) 30
SetI ASST 2 cut(s) 27, 50
SfcI CTRYAG 1 cut(s) 26
SgeI CNNG 8 cut(s) 23, 32, 37, 57, 68, 88, 109, 140
Sse9I AATT 1 cut(s) 123
TaaI ACNGT 1 cut(s) 108
TasI AATT 1 cut(s) 123
TspDTI ATGAA 1 cut(s) 8
XapI RAATTY 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.