Prupe.4G285800_v2.0.a1

Belongs to the cyclin family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
OG0000541
Physical Location & Seq
Forward (+)
24917237 .. 24918195
959 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G285800.1

Sequence Viewer

Length: 468 bp
ATGCCCTTAAACTCCCGGAAAACCTACAAATTATCCCCTTCATCAATCAAATCATTAGTGAATCTGTTAAATACTGATGTGGCGAATCCTCTCCCTCCCGACTCAACCCCACCTCTCAGCCACCTCTCTCTCGTCGCCCACCCCAAACCCTACTCTCTTTCTCTCTCCTTCTCCCTCCCAACCCACCCCAACTTCTCCAGCATAGGCCCAACCGCAACCTTCGATCGCTCTGTCCTACAAATTCTAGCTCCCAATAAGCGAGTTGTGTTGGGTGAGATCTCCAACTCGACAAACAACGTCGTTTCCACCCTGAACTCGACTCCAAAGAAACCCAAGAGTAGCTTCAAGAAGAAGAAGACGACGACAAAGAGGGAAGAGGAGGCCCTCAAGACTGAAATCATTATGAGATCTATTGATCCACGCAAGTCTGATCATTCGCCTTCTATATATTGCTATCTTCTTTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04110 ko04152 ko04218 ko04914 ko05161 ko05165 ko05169 ko05203 map04110 map04152 map04218 map04914 map05161 map05165 map05169 map05203
Pfam Domains
Protein Families
Cyclin_C Cyclin_N

Protein Analysis

156

Amino Acids

17.07

Weight (kDa)

9.96

Isoelectric Point (pI)

48.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000541)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G47210 AT1G47210 AT1G47220 AT1G47230 AT1G47230 AT2G01310 AT5G43080 AT5G43080
fragaria_vesca FvH4_2g04770 FvH4_2g04770 FvH4_2g04770 FvH4_2g33510 FvH4_2g33510 FvH4_2g33510 FvH4_2g33511 FvH4_2g33511 FvH4_2g33511 FvH4_2g33511 FvH4_2g33530 FvH4_2g33530
malus_domestica MD05G1092000.v1.1 MD08G1091000.v1.1 MD08G1091200.v1.1 MD10G1100200.v1.1 MD10G1100700.v1.1 MD12G1105600.v1.1 MD15G1075100.v1.1 MD15G1075200.v1.1
prunus_persica Prupe.1G428000_v2.0.a1 Prupe.1G428100_v2.0.a1 Prupe.4G285800_v2.0.a1 Prupe.8G137700_v2.0.a1 Prupe.8G137700_v2.0.a1
pyrus_communis pycom05g09170 pycom08g07360 pycom08g07370 pycom15g07000 pycom15g07020
rosa_chinensis RchiOBHm_Chr3g0465621 RchiOBHm_Chr6g0254421 RchiOBHm_Chr6g0254451 RchiOBHm_Chr6g0308961 RchiOBHm_Chr6g0308971 RchiOBHm_Chr6g0308991 RchiOBHm_Chr7g0190851
rosa_laevigata RLG00000003915 RLG00000010598 RLG00000010599 RLG00000010600 RLG00000014913
rosa_multiflora Rmu_sc0009578.1_g000002 Rmu_sc0009578.1_g000003 Rmu_sc0029942.1_g000001 Rmu_sc0036151.1_g000001 Rmu_sc0036151.1_g000002 Rmu_sc0037719.1_g000001 Rmu_sc0042877.1_g000001 Rmu_ssc0000481.1_g000003
rosa_roxburghii Rroxscaffold_7G00159740 Rroxscaffold_7G00159750 Rroxscaffold_7G00159760 Rroxscaffold_7G00159770 Rroxscaffold_7G00210810
rosa_rugosa Rorug05G0552200 Rorug05G0552300 Rorug05G0552400
rosa_samantha Rh3CG081000 Rh6AG069300 Rh6AG481300 Rh6AG481600 Rh6BG062000 Rh6BG490400 Rh6BG490500 Rh6BG490600 Rh6CG062100 Rh6CG495700 Rh6CG495900 Rh6DG059100 Rh6DG481600 Rh6DG481700 Rh6DG481800
rosa_wichuraiana Rw6G006090 Rw6G041930 Rw6G041940

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 213
AclWI GGATC 1 cut(s) 410
AcsI RAATTY 1 cut(s) 240
AgsI TTSAA 1 cut(s) 346
AjuI GAANNNNNNNTTGG 2 cut(s) 326, 358
AluBI AGCT 2 cut(s) 248, 342
AluI AGCT 2 cut(s) 248, 342
AlwI GGATC 1 cut(s) 410
AoxI GGCC 2 cut(s) 205, 381
ApoI RAATTY 1 cut(s) 240
AspS9I GGNCC 2 cut(s) 206, 382
AsuC2I CCSGG 1 cut(s) 16
AsuHPI GGTGA 1 cut(s) 284
BbsI GAAGAC 1 cut(s) 362
BclI TGATCA 1 cut(s) 430
BcnI CCSGG 1 cut(s) 16
BfaI CTAG 1 cut(s) 245
BglII AGATCT 2 cut(s) 276, 407
Bme1390I CCNGG 1 cut(s) 16
BmgT120I GGNCC 2 cut(s) 206, 382
BmrFI CCNGG 1 cut(s) 16
BpiI GAAGAC 1 cut(s) 362
BpmI CTGGAG 1 cut(s) 181
BpuEI CTTGAG 1 cut(s) 371
BpuMI CCSGG 1 cut(s) 16
BseMII CTCAG 1 cut(s) 130
BseRI GAGGAG 1 cut(s) 392
Bsh1285I CGRYCG 1 cut(s) 226
BshFI GGCC 2 cut(s) 207, 383
BsiEI CGRYCG 1 cut(s) 226
BsiSI CCGG 1 cut(s) 16
BsnI GGCC 2 cut(s) 207, 383
Bsp143I GATC 5 cut(s) 223, 276, 407, 415, 430
BspACI CCGC 1 cut(s) 213
BspANI GGCC 2 cut(s) 207, 383
BspCNI CTCAG 1 cut(s) 129
BspPI GGATC 1 cut(s) 410
BssMI GATC 5 cut(s) 223, 276, 407, 415, 430
Bst6I CTCTTC 1 cut(s) 369
BstDEI CTNAG 1 cut(s) 116
BstKTI GATC 5 cut(s) 226, 279, 410, 418, 433
BstMBI GATC 5 cut(s) 223, 276, 407, 415, 430
BstMCI CGRYCG 1 cut(s) 226
BstSCI CCNGG 1 cut(s) 14
BstV2I GAAGAC 1 cut(s) 362
BstX2I RGATCY 2 cut(s) 276, 407
BstYI RGATCY 2 cut(s) 276, 407
BsuRI GGCC 2 cut(s) 207, 383
Cfr13I GGNCC 2 cut(s) 206, 382
CviJI RGCY 5 cut(s) 120, 207, 248, 342, 383
CviKI_1 RGCY 5 cut(s) 120, 207, 248, 342, 383
DdeI CTNAG 1 cut(s) 116
DpnI GATC 5 cut(s) 225, 278, 409, 417, 432
DpnII GATC 5 cut(s) 223, 276, 407, 415, 430
Eam1104I CTCTTC 1 cut(s) 369
EarI CTCTTC 1 cut(s) 369
EcoO109I RGGNCCY 1 cut(s) 382
FaiI YATR 5 cut(s) 203, 404, 446, 448, 466
FalI AAGNNNNNCTT 2 cut(s) 326, 358
FbaI TGATCA 1 cut(s) 430
FspBI CTAG 1 cut(s) 245
GsuI CTGGAG 1 cut(s) 181
HaeIII GGCC 2 cut(s) 207, 383
HapII CCGG 1 cut(s) 16
HinfI GANTC 4 cut(s) 61, 85, 101, 319
HpaII CCGG 1 cut(s) 16
HphI GGTGA 1 cut(s) 284
Hpy188I TCNGA 1 cut(s) 430
Hpy188III TCNNGA 3 cut(s) 98, 346, 388
Hpy99I CGWCG 3 cut(s) 137, 302, 364
HpyAV CCTTC 4 cut(s) 48, 178, 229, 450
HpyCH4IV ACGT 1 cut(s) 297
HpyF3I CTNAG 1 cut(s) 116
HpySE526I ACGT 1 cut(s) 297
Ksp22I TGATCA 1 cut(s) 430
Kzo9I GATC 5 cut(s) 223, 276, 407, 415, 430
LmnI GCTCC 1 cut(s) 253
LpnPI CCDG 3 cut(s) 29, 211, 323
MaeI CTAG 1 cut(s) 245
MaeII ACGT 1 cut(s) 297
MalI GATC 5 cut(s) 225, 278, 409, 417, 432
MboI GATC 5 cut(s) 223, 276, 407, 415, 430
MboII GAAGA 5 cut(s) 361, 364, 367, 386, 449
MflI RGATCY 2 cut(s) 276, 407
MluCI AATT 2 cut(s) 29, 240
MlyI GAGTC 2 cut(s) 95, 313
MmeI TCCRAC 1 cut(s) 306
MnlI CCTC 9 cut(s) 99, 105, 123, 134, 185, 363, 370, 373, 395
MseI TTAA 2 cut(s) 8, 68
MspI CCGG 1 cut(s) 16
MspR9I CCNGG 1 cut(s) 16
NciI CCSGG 1 cut(s) 16
NdeII GATC 5 cut(s) 223, 276, 407, 415, 430
PfeI GAWTC 2 cut(s) 61, 85
PfoI TCCNGGA 1 cut(s) 14
Ple19I CGATCG 1 cut(s) 226
PleI GAGTC 2 cut(s) 95, 313
PpsI GAGTC 2 cut(s) 95, 313
PspPI GGNCC 2 cut(s) 206, 382
PsuI RGATCY 2 cut(s) 276, 407
PvuI CGATCG 1 cut(s) 226
SaqAI TTAA 2 cut(s) 8, 68
Sau3AI GATC 5 cut(s) 223, 276, 407, 415, 430
Sau96I GGNCC 2 cut(s) 206, 382
SchI GAGTC 2 cut(s) 95, 313
ScrFI CCNGG 1 cut(s) 16
SetI ASST 7 cut(s) 26, 115, 126, 221, 250, 300, 344
SmlI CTYRAG 1 cut(s) 386
SmoI CTYRAG 1 cut(s) 386
Sse9I AATT 2 cut(s) 29, 240
SsiI CCGC 1 cut(s) 213
SspMI CTAG 1 cut(s) 245
StyD4I CCNGG 1 cut(s) 14
TaiI ACGT 1 cut(s) 300
TaqI TCGA 3 cut(s) 222, 287, 317
TasI AATT 2 cut(s) 29, 240
TfiI GAWTC 2 cut(s) 61, 85
Tru1I TTAA 2 cut(s) 8, 68
Tru9I TTAA 2 cut(s) 8, 68
TspDTI ATGAA 2 cut(s) 30, 453
XapI RAATTY 1 cut(s) 240
XspI CTAG 1 cut(s) 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.