Prupe.8G048000_v2.0.a1

Belongs to the Orn Lys Arg decarboxylase class-II family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
OG0000734
Physical Location & Seq
Forward (+)
5194540 .. 5196505
1966 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G048000.1

Sequence Viewer

Length: 402 bp
ATGGCTGAGCCAGGAAGGTTCTTTGCTGAAACTGCATTCACAATGGTTGCAAATGTGATGGGGAAGAGAGTGAGGGGAGAGCAAAGAGAGTATTGGATTAGTGATGGAATTTATGGGTCATTTAATCTTCCAGCATATGACAAATCCTCTATGCAAATCTCACCCCTACAAATTCTAAGTCCTCACCAAAATCAAGTGACATATTCATCAACAGTTTTTGGGCCGACTTGTGATTCATTGGACATAGTTGTTGCTGACTGCAAACTGCCTGAATTAAAGCTGAATGATTATCTTGTGTTCCACAACATGGGCGCCTACACAACTTCTGCTGGAACCAACTTCAATGGCTTCTGCATTTCTGCTATTCCTACGTACGTGGCATTTACAAGTGCTAATAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00330 ko00480 ko01100 ko01110 ko01130 map00330 map00480 map01100 map01110 map01130
Pfam Domains
Protein Families
Orn_Arg_deC_N Orn_DAP_Arg_deC

Protein Analysis

134

Amino Acids

14.67

Weight (kDa)

5.16

Isoelectric Point (pI)

26.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 311
AccB7I CCANNNNNTGG 1 cut(s) 307
AcsI RAATTY 2 cut(s) 108, 171
AcyI GRCGYC 1 cut(s) 312
AfaI GTAC 1 cut(s) 374
AfiI CCNNNNNNNGG 1 cut(s) 307
AgsI TTSAA 1 cut(s) 343
AjnI CCWGG 1 cut(s) 10
AluBI AGCT 1 cut(s) 280
AluI AGCT 1 cut(s) 280
AoxI GGCC 1 cut(s) 221
ApoI RAATTY 2 cut(s) 108, 171
ArsI GACNNNNNNTTYG 2 cut(s) 163, 195
AspLEI GCGC 1 cut(s) 314
AspS9I GGNCC 1 cut(s) 221
AsuHPI GGTGA 2 cut(s) 153, 176
BanI GGYRCC 1 cut(s) 311
BccI CCATC 2 cut(s) 52, 98
BciT130I CCWGG 1 cut(s) 12
BfoI RGCGCY 1 cut(s) 315
BlpI GCTNAGC 1 cut(s) 6
Bme1390I CCNGG 1 cut(s) 12
BmgT120I GGNCC 1 cut(s) 221
BmiI GGNNCC 2 cut(s) 313, 334
BmrFI CCNGG 1 cut(s) 12
Bpu1102I GCTNAGC 1 cut(s) 6
BsaAI YACGTR 2 cut(s) 372, 376
BsaHI GRCGYC 1 cut(s) 312
Bsc4I CCNNNNNNNGG 1 cut(s) 307
BseBI CCWGG 1 cut(s) 12
BseLI CCNNNNNNNGG 1 cut(s) 307
BshFI GGCC 1 cut(s) 223
BshNI GGYRCC 1 cut(s) 311
BsiWI CGTACG 1 cut(s) 372
BslI CCNNNNNNNGG 1 cut(s) 307
BsmI GAATGC 1 cut(s) 35
BsnI GGCC 1 cut(s) 223
Bsp1720I GCTNAGC 1 cut(s) 6
BspANI GGCC 1 cut(s) 223
BspLI GGNNCC 2 cut(s) 313, 334
BspT107I GGYRCC 1 cut(s) 311
BssNI GRCGYC 1 cut(s) 312
Bst2UI CCWGG 1 cut(s) 12
Bst4CI ACNGT 1 cut(s) 214
Bst6I CTCTTC 1 cut(s) 59
BstACI GRCGYC 1 cut(s) 312
BstBAI YACGTR 2 cut(s) 372, 376
BstDEI CTNAG 2 cut(s) 6, 176
BstH2I RGCGCY 1 cut(s) 315
BstHHI GCGC 1 cut(s) 314
BstMWI GCNNNNNNNGC 1 cut(s) 32
BstNI CCWGG 1 cut(s) 12
BstSCI CCNGG 1 cut(s) 10
BstSNI TACGTA 1 cut(s) 372
BsuRI GGCC 1 cut(s) 223
CfoI GCGC 1 cut(s) 314
Cfr13I GGNCC 1 cut(s) 221
Csp6I GTAC 1 cut(s) 373
CviAII CATG 1 cut(s) 307
CviJI RGCY 5 cut(s) 5, 10, 223, 280, 348
CviKI_1 RGCY 5 cut(s) 5, 10, 223, 280, 348
CviQI GTAC 1 cut(s) 373
DdeI CTNAG 2 cut(s) 6, 176
DinI GGCGCC 1 cut(s) 313
Eam1104I CTCTTC 1 cut(s) 59
EarI CTCTTC 1 cut(s) 59
Eco105I TACGTA 1 cut(s) 372
EcoRII CCWGG 1 cut(s) 10
EgeI GGCGCC 1 cut(s) 313
EheI GGCGCC 1 cut(s) 313
FaeI CATG 1 cut(s) 310
FaiI YATR 7 cut(s) 114, 136, 138, 152, 202, 245, 308
FatI CATG 1 cut(s) 306
FauNDI CATATG 1 cut(s) 136
GlaI GCGC 1 cut(s) 313
HaeII RGCGCY 1 cut(s) 315
HaeIII GGCC 1 cut(s) 223
HhaI GCGC 1 cut(s) 314
Hin1I GRCGYC 1 cut(s) 312
Hin1II CATG 1 cut(s) 310
Hin6I GCGC 1 cut(s) 312
HinP1I GCGC 1 cut(s) 312
HinfI GANTC 1 cut(s) 233
HphI GGTGA 2 cut(s) 153, 176
HpyAV CCTTC 1 cut(s) 9
HpyCH4III ACNGT 1 cut(s) 214
HpyCH4IV ACGT 2 cut(s) 371, 375
HpyCH4V TGCA 5 cut(s) 35, 50, 154, 261, 354
HpyF10VI GCNNNNNNNGC 1 cut(s) 32
HpyF3I CTNAG 2 cut(s) 6, 176
HpySE526I ACGT 2 cut(s) 371, 375
Hsp92I GRCGYC 1 cut(s) 312
Hsp92II CATG 1 cut(s) 310
HspAI GCGC 1 cut(s) 312
KasI GGCGCC 1 cut(s) 311
LpnPI CCDG 4 cut(s) 24, 144, 282, 315
MaeII ACGT 2 cut(s) 371, 375
MaeIII GTNAC 1 cut(s) 196
MboII GAAGA 2 cut(s) 76, 119
MluCI AATT 4 cut(s) 108, 171, 272, 397
Mly113I GGCGCC 1 cut(s) 312
MnlI CCTC 3 cut(s) 66, 157, 192
MseI TTAA 3 cut(s) 123, 275, 400
MspR9I CCNGG 1 cut(s) 12
Mva1269I GAATGC 1 cut(s) 35
MvaI CCWGG 1 cut(s) 12
MwoI GCNNNNNNNGC 1 cut(s) 32
NarI GGCGCC 1 cut(s) 312
NdeI CATATG 1 cut(s) 136
NlaIII CATG 1 cut(s) 310
NlaIV GGNNCC 2 cut(s) 313, 334
NmuCI GTSAC 1 cut(s) 196
PctI GAATGC 1 cut(s) 35
PfeI GAWTC 1 cut(s) 233
Pfl23II CGTACG 1 cut(s) 372
PflMI CCANNNNNTGG 1 cut(s) 307
PluTI GGCGCC 1 cut(s) 315
Ppu21I YACGTR 2 cut(s) 372, 376
Psp6I CCWGG 1 cut(s) 10
PspGI CCWGG 1 cut(s) 10
PspLI CGTACG 1 cut(s) 372
PspN4I GGNNCC 2 cut(s) 313, 334
PspPI GGNCC 1 cut(s) 221
RsaI GTAC 1 cut(s) 374
RsaNI GTAC 1 cut(s) 373
SaqAI TTAA 3 cut(s) 123, 275, 400
Sau96I GGNCC 1 cut(s) 221
ScrFI CCNGG 1 cut(s) 12
SetI ASST 4 cut(s) 20, 282, 374, 378
SfoI GGCGCC 1 cut(s) 313
SnaBI TACGTA 1 cut(s) 372
Sse9I AATT 4 cut(s) 108, 171, 272, 397
SspDI GGCGCC 1 cut(s) 311
StyD4I CCNGG 1 cut(s) 10
TaaI ACNGT 1 cut(s) 214
TaiI ACGT 2 cut(s) 374, 378
TasI AATT 4 cut(s) 108, 171, 272, 397
TfiI GAWTC 1 cut(s) 233
Tru1I TTAA 3 cut(s) 123, 275, 400
Tru9I TTAA 3 cut(s) 123, 275, 400
TseFI GTSAC 1 cut(s) 196
Tsp45I GTSAC 1 cut(s) 196
TspDTI ATGAA 2 cut(s) 195, 225
Van91I CCANNNNNTGG 1 cut(s) 307
XapI RAATTY 2 cut(s) 108, 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.