pycom01g08160

RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Forward (+)
9126547 .. 9126930
384 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g08160.1

Sequence Viewer

Length: 384 bp
ATGTGTGAGGCAGAGGAATATTGGATTTTTGGATGTGTGCAGCATAGTTCTTTCCTAAGATCTTGGTCTATACATTGTAGTGAGGCAGTGAATATATTTGGGGAAAAAGGGTATCATATTTGGTGTGGACAATCACTTATGTTTACAAAAGGTTCGGCTATTGGACAAGATGTCGTGAACAAGGCTAAAGCATTTGATGCAAAGCATCGGTTGATAGCAAGTGCATCAGAAAATGTCATTTCCCTTGACAAAAAAGTGGGGCTTACAGAGAAATTGACAGTAGGCATTTCCAAGGTTAATGAGAAAGTGAAGTATGTTGATCAGAGGCTTAATGTCTCGGATAAAACAATGGCAGCAATATTTGCAACAGAGAAAATTGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

128

Amino Acids

14.19

Weight (kDa)

7.68

Isoelectric Point (pI)

34.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 380
AhdI GACNNNNNGTC 1 cut(s) 170
Alw26I GTCTC 1 cut(s) 340
ApeKI GCWGC 2 cut(s) 40, 353
BbvI GCAGC 2 cut(s) 52, 365
BclI TGATCA 1 cut(s) 319
BcoDI GTCTC 1 cut(s) 340
BglII AGATCT 1 cut(s) 59
BisI GCNGC 2 cut(s) 41, 354
BlsI GCNGC 2 cut(s) 42, 355
BmeRI GACNNNNNGTC 1 cut(s) 170
BmsI GCATC 3 cut(s) 187, 214, 233
BsaJI CCNNGG 1 cut(s) 291
BseDI CCNNGG 1 cut(s) 291
BseGI GGATG 1 cut(s) 38
BseXI GCAGC 2 cut(s) 52, 365
BsgI GTGCAG 1 cut(s) 59
BsmAI GTCTC 1 cut(s) 340
Bsp143I GATC 2 cut(s) 59, 319
BssECI CCNNGG 1 cut(s) 291
BssMI GATC 2 cut(s) 59, 319
BssT1I CCWWGG 1 cut(s) 291
Bst4CI ACNGT 1 cut(s) 280
BstAPI GCANNNNNTGC 2 cut(s) 197, 362
BstDEI CTNAG 1 cut(s) 56
BstF5I GGATG 1 cut(s) 38
BstKTI GATC 2 cut(s) 62, 322
BstMAI GTCTC 1 cut(s) 340
BstMBI GATC 2 cut(s) 59, 319
BstMWI GCNNNNNNNGC 2 cut(s) 197, 362
BstV1I GCAGC 2 cut(s) 52, 365
BstX2I RGATCY 1 cut(s) 59
BstYI RGATCY 1 cut(s) 59
BtsCI GGATG 1 cut(s) 38
BtsI GCAGTG 1 cut(s) 93
BtsIMutI CAGTG 1 cut(s) 93
CviJI RGCY 4 cut(s) 158, 185, 262, 328
CviKI_1 RGCY 4 cut(s) 158, 185, 262, 328
DdeI CTNAG 1 cut(s) 56
DpnI GATC 2 cut(s) 61, 321
DpnII GATC 2 cut(s) 59, 319
DriI GACNNNNNGTC 1 cut(s) 170
Eam1105I GACNNNNNGTC 1 cut(s) 170
Eco130I CCWWGG 1 cut(s) 291
EcoT14I CCWWGG 1 cut(s) 291
ErhI CCWWGG 1 cut(s) 291
FaiI YATR 6 cut(s) 45, 71, 95, 117, 140, 315
FalI AAGNNNNNCTT 2 cut(s) 246, 278
FbaI TGATCA 1 cut(s) 319
Fnu4HI GCNGC 2 cut(s) 41, 354
FokI GGATG 1 cut(s) 45
Fsp4HI GCNGC 2 cut(s) 41, 354
GluI GCNGC 2 cut(s) 41, 354
Hpy166II GTNNAC 3 cut(s) 128, 144, 178
Hpy188I TCNGA 3 cut(s) 229, 324, 340
Hpy188III TCNNGA 1 cut(s) 175
Hpy8I GTNNAC 3 cut(s) 128, 144, 178
HpyCH4III ACNGT 1 cut(s) 280
HpyCH4V TGCA 4 cut(s) 40, 200, 224, 365
HpyF10VI GCNNNNNNNGC 2 cut(s) 197, 362
HpyF3I CTNAG 1 cut(s) 56
Ksp22I TGATCA 1 cut(s) 319
Kzo9I GATC 2 cut(s) 59, 319
Lsp1109I GCAGC 2 cut(s) 52, 365
LweI GCATC 3 cut(s) 187, 214, 233
MalI GATC 2 cut(s) 61, 321
MboI GATC 2 cut(s) 59, 319
MflI RGATCY 1 cut(s) 59
MluCI AATT 2 cut(s) 272, 375
MnlI CCTC 3 cut(s) 7, 76, 318
MseI TTAA 2 cut(s) 297, 330
MslI CAYNNNNRTG 1 cut(s) 78
MwoI GCNNNNNNNGC 2 cut(s) 197, 362
NdeII GATC 2 cut(s) 59, 319
PkrI GCNGC 2 cut(s) 42, 355
PsuI RGATCY 1 cut(s) 59
RseI CAYNNNNRTG 1 cut(s) 78
SaqAI TTAA 2 cut(s) 297, 330
SatI GCNGC 2 cut(s) 41, 354
Sau3AI GATC 2 cut(s) 59, 319
SetI ASST 2 cut(s) 154, 297
SfaNI GCATC 3 cut(s) 187, 214, 233
SgeI CNNG 8 cut(s) 75, 179, 187, 193, 231, 257, 304, 349
SmiMI CAYNNNNRTG 1 cut(s) 78
Sse9I AATT 2 cut(s) 272, 375
SspI AATATT 2 cut(s) 20, 360
StyI CCWWGG 1 cut(s) 291
TaaI ACNGT 1 cut(s) 280
TasI AATT 2 cut(s) 272, 375
Tru1I TTAA 2 cut(s) 297, 330
Tru9I TTAA 2 cut(s) 297, 330
TscAI CASTG 1 cut(s) 93
TseI GCWGC 2 cut(s) 40, 353
TspRI CASTG 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.