RchiOBHm_Chr5g0077261

RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0000747
Physical Location & Seq
Reverse (-)
83131327 .. 83132468
1142 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35185

Sequence Viewer

Length: 207 bp
ATGGCAGCAATATTTGCAGCAGAGAGAAAATTAAATGATACTGGATCAGCTGTCAAAACAAGCAGGTATGTGACTGCGAGAGCAACTTGGTTCAATGGTGCTTTTAGCAAGGTGGCAAAGGCAGGGCAGGCTGCAGGTACGAAAACCAGAGAAAAGTTCCATATGGCTGTGTCAAACTTGACTGCAAAGGATCCAATAGCTGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RRM_1

Protein Analysis

68

Amino Acids

7.2

Weight (kDa)

10.45

Isoelectric Point (pI)

0.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 54, 125
AclWI GGATC 3 cut(s) 52, 185, 198
AfaI GTAC 1 cut(s) 139
AgsI TTSAA 1 cut(s) 94
AluBI AGCT 2 cut(s) 50, 200
AluI AGCT 2 cut(s) 50, 200
AlwI GGATC 3 cut(s) 52, 185, 198
ApeKI GCWGC 4 cut(s) 5, 17, 131, 200
BamHI GGATCC 1 cut(s) 190
BbvI GCAGC 4 cut(s) 17, 29, 118, 187
BfmI CTRYAG 1 cut(s) 132
BfuAI ACCTGC 2 cut(s) 54, 125
BisI GCNGC 4 cut(s) 6, 18, 132, 201
BlsI GCNGC 4 cut(s) 7, 19, 133, 202
BmiI GGNNCC 1 cut(s) 192
Bse1I ACTGG 1 cut(s) 46
BseNI ACTGG 1 cut(s) 46
BseXI GCAGC 4 cut(s) 17, 29, 118, 187
Bsp143I GATC 2 cut(s) 44, 190
BspLI GGNNCC 1 cut(s) 192
BspMAI CTGCAG 1 cut(s) 136
BspMI ACCTGC 2 cut(s) 54, 125
BspPI GGATC 3 cut(s) 52, 185, 198
BsrI ACTGG 1 cut(s) 46
BssMI GATC 2 cut(s) 44, 190
BstAPI GCANNNNNTGC 1 cut(s) 14
BstC8I GCNNGC 1 cut(s) 129
BstKTI GATC 2 cut(s) 47, 193
BstMBI GATC 2 cut(s) 44, 190
BstMWI GCNNNNNNNGC 2 cut(s) 14, 128
BstSFI CTRYAG 1 cut(s) 132
BstV1I GCAGC 4 cut(s) 17, 29, 118, 187
BstX2I RGATCY 1 cut(s) 190
BstYI RGATCY 1 cut(s) 190
BveI ACCTGC 2 cut(s) 54, 125
Cac8I GCNNGC 1 cut(s) 129
Csp6I GTAC 1 cut(s) 138
CviJI RGCY 4 cut(s) 50, 131, 167, 200
CviKI_1 RGCY 4 cut(s) 50, 131, 167, 200
CviQI GTAC 1 cut(s) 138
DpnI GATC 2 cut(s) 46, 192
DpnII GATC 2 cut(s) 44, 190
FaiI YATR 4 cut(s) 69, 162, 164, 205
FauNDI CATATG 1 cut(s) 162
Fnu4HI GCNGC 4 cut(s) 6, 18, 132, 201
Fsp4HI GCNGC 4 cut(s) 6, 18, 132, 201
GluI GCNGC 4 cut(s) 6, 18, 132, 201
HpyCH4V TGCA 4 cut(s) 17, 134, 185, 203
HpyF10VI GCNNNNNNNGC 2 cut(s) 14, 128
Kzo9I GATC 2 cut(s) 44, 190
LpnPI CCDG 6 cut(s) 27, 49, 108, 113, 120, 160
Lsp1109I GCAGC 4 cut(s) 17, 29, 118, 187
MaeIII GTNAC 1 cut(s) 70
MalI GATC 2 cut(s) 46, 192
MboI GATC 2 cut(s) 44, 190
MflI RGATCY 1 cut(s) 190
MluCI AATT 1 cut(s) 29
MseI TTAA 1 cut(s) 32
MspA1I CMGCKG 1 cut(s) 50
MwoI GCNNNNNNNGC 2 cut(s) 14, 128
NdeI CATATG 1 cut(s) 162
NdeII GATC 2 cut(s) 44, 190
NlaIV GGNNCC 1 cut(s) 192
NmuCI GTSAC 1 cut(s) 70
PkrI GCNGC 4 cut(s) 7, 19, 133, 202
PspN4I GGNNCC 1 cut(s) 192
PstI CTGCAG 1 cut(s) 136
PsuI RGATCY 1 cut(s) 190
PvuII CAGCTG 1 cut(s) 50
RsaI GTAC 1 cut(s) 139
RsaNI GTAC 1 cut(s) 138
SaqAI TTAA 1 cut(s) 32
SatI GCNGC 4 cut(s) 6, 18, 132, 201
Sau3AI GATC 2 cut(s) 44, 190
SetI ASST 5 cut(s) 52, 68, 114, 139, 202
SfcI CTRYAG 1 cut(s) 132
Sse9I AATT 1 cut(s) 29
SspI AATATT 1 cut(s) 12
TasI AATT 1 cut(s) 29
Tru1I TTAA 1 cut(s) 32
Tru9I TTAA 1 cut(s) 32
TseFI GTSAC 1 cut(s) 70
TseI GCWGC 4 cut(s) 5, 17, 131, 200
Tsp45I GTSAC 1 cut(s) 70
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.