pycom07g12190

RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
Physical Location & Seq
Forward (+)
13472621 .. 13472929
309 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g12190.1

Sequence Viewer

Length: 309 bp
ATGTGTGGACAATCACTTATGTTTGAAAAGGGTTCGACTATTGGACAAGATGCTGTGAACAAGGCTAAAGCATTTGATGAAAAGCATCGGTTGGCAGCAAGTGCATCAGAGAAGCTCATTTCCTTTGACATGAAAGTGGGGCTTGCAGAGAAATTGACAGTAGGCATTTCTGTGGTTAATGAGAAAGTGAAGTTTGTTGATCAGAGGCTTCATGTCTCAGATAAAACAATGGTAGCAGTATTTGCAATAGAGAGAAAATTGAAATATACGCGGTCAGCTGTCAAAAAAATCAGGCATGTGATCGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

103

Amino Acids

11.35

Weight (kDa)

9.84

Isoelectric Point (pI)

19.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 271
AciI CCGC 1 cut(s) 271
AgsI TTSAA 2 cut(s) 26, 262
AluBI AGCT 2 cut(s) 115, 278
AluI AGCT 2 cut(s) 115, 278
Alw26I GTCTC 1 cut(s) 220
ApeKI GCWGC 1 cut(s) 95
BbvI GCAGC 1 cut(s) 107
BclI TGATCA 1 cut(s) 199
BcoDI GTCTC 1 cut(s) 220
BisI GCNGC 1 cut(s) 96
BlsI GCNGC 1 cut(s) 97
BmsI GCATC 3 cut(s) 40, 94, 113
BseMII CTCAG 1 cut(s) 231
BseXI GCAGC 1 cut(s) 107
Bsh1236I CGCG 1 cut(s) 271
BsmAI GTCTC 1 cut(s) 220
Bsp143I GATC 2 cut(s) 199, 300
BspACI CCGC 1 cut(s) 271
BspCNI CTCAG 1 cut(s) 230
BspFNI CGCG 1 cut(s) 271
BssMI GATC 2 cut(s) 199, 300
Bst4CI ACNGT 1 cut(s) 160
BstAPI GCANNNNNTGC 2 cut(s) 101, 242
BstC8I GCNNGC 1 cut(s) 144
BstDEI CTNAG 1 cut(s) 217
BstFNI CGCG 1 cut(s) 271
BstKTI GATC 2 cut(s) 202, 303
BstMAI GTCTC 1 cut(s) 220
BstMBI GATC 2 cut(s) 199, 300
BstMWI GCNNNNNNNGC 2 cut(s) 101, 242
BstNSI RCATGY 1 cut(s) 299
BstUI CGCG 1 cut(s) 271
BstV1I GCAGC 1 cut(s) 107
Cac8I GCNNGC 1 cut(s) 144
CviAII CATG 3 cut(s) 130, 212, 296
CviJI RGCY 5 cut(s) 65, 115, 142, 208, 278
CviKI_1 RGCY 5 cut(s) 65, 115, 142, 208, 278
DdeI CTNAG 1 cut(s) 217
DpnI GATC 2 cut(s) 201, 302
DpnII GATC 2 cut(s) 199, 300
FaeI CATG 3 cut(s) 133, 215, 299
FaiI YATR 5 cut(s) 20, 131, 213, 267, 297
FalI AAGNNNNNCTT 2 cut(s) 126, 158
FatI CATG 3 cut(s) 129, 211, 295
FbaI TGATCA 1 cut(s) 199
Fnu4HI GCNGC 1 cut(s) 96
Fsp4HI GCNGC 1 cut(s) 96
GluI GCNGC 1 cut(s) 96
Hin1II CATG 3 cut(s) 133, 215, 299
Hpy166II GTNNAC 2 cut(s) 8, 58
Hpy188I TCNGA 3 cut(s) 109, 204, 220
Hpy8I GTNNAC 2 cut(s) 8, 58
HpyCH4III ACNGT 1 cut(s) 160
HpyCH4V TGCA 3 cut(s) 104, 146, 245
HpyF10VI GCNNNNNNNGC 2 cut(s) 101, 242
HpyF3I CTNAG 1 cut(s) 217
Hsp92II CATG 3 cut(s) 133, 215, 299
Ksp22I TGATCA 1 cut(s) 199
Kzo9I GATC 2 cut(s) 199, 300
LpnPI CCDG 1 cut(s) 277
Lsp1109I GCAGC 1 cut(s) 107
LweI GCATC 3 cut(s) 40, 94, 113
MalI GATC 2 cut(s) 201, 302
MboI GATC 2 cut(s) 199, 300
MluCI AATT 2 cut(s) 152, 257
MnlI CCTC 1 cut(s) 198
MseI TTAA 1 cut(s) 177
MslI CAYNNNNRTG 2 cut(s) 134, 170
MspA1I CMGCKG 1 cut(s) 278
MvnI CGCG 1 cut(s) 271
MwoI GCNNNNNNNGC 2 cut(s) 101, 242
NdeII GATC 2 cut(s) 199, 300
NlaIII CATG 3 cut(s) 133, 215, 299
NspI RCATGY 1 cut(s) 299
PkrI GCNGC 1 cut(s) 97
PvuII CAGCTG 1 cut(s) 278
RseI CAYNNNNRTG 2 cut(s) 134, 170
SaqAI TTAA 1 cut(s) 177
SatI GCNGC 1 cut(s) 96
Sau3AI GATC 2 cut(s) 199, 300
SetI ASST 2 cut(s) 117, 280
SfaNI GCATC 3 cut(s) 40, 94, 113
SgeI CNNG 8 cut(s) 59, 73, 111, 142, 155, 224, 282, 304
SmiMI CAYNNNNRTG 2 cut(s) 134, 170
Sse9I AATT 2 cut(s) 152, 257
SsiI CCGC 1 cut(s) 271
TaaI ACNGT 1 cut(s) 160
TaqI TCGA 1 cut(s) 35
TasI AATT 2 cut(s) 152, 257
Tru1I TTAA 1 cut(s) 177
Tru9I TTAA 1 cut(s) 177
TseI GCWGC 1 cut(s) 95
TspDTI ATGAA 3 cut(s) 93, 146, 200
XceI RCATGY 1 cut(s) 299
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.