Rroxscaffold_2G00110930

RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
35435135 .. 35435914
780 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00110930.1

Sequence Viewer

Length: 222 bp
ATGGTTAATCGGATTATGACTATATCTCCTGTTGAAAATTATGTACCAATTAATGAGATGCTGGATAAAGATGGCTCTCCTAACAATGGAAGGGTGTATGTAAATAGAGCTCAAGATGTAGTGTCTAGTATGTTTGCAAAAGGTTCAGCAATTGGACAAGATGCCGTGAACAAGGCTAAAGCATTTGATGAAAAGCATCGGTTGAGAGCAAGTGCATCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.01

Weight (kDa)

9.22

Isoelectric Point (pI)

36.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 45
AfiI CCNNNNNNNGG 1 cut(s) 86
AgsI TTSAA 1 cut(s) 35
AluBI AGCT 1 cut(s) 110
AluI AGCT 1 cut(s) 110
Alw21I GWGCWC 1 cut(s) 112
AseI ATTAAT 1 cut(s) 51
BanII GRGCYC 1 cut(s) 112
Bbv12I GWGCWC 1 cut(s) 112
BccI CCATC 1 cut(s) 65
BceAI ACGGC 1 cut(s) 149
BfaI CTAG 1 cut(s) 126
BmsI GCATC 3 cut(s) 48, 151, 205
BpuEI CTTGAG 1 cut(s) 96
BsaXI ACNNNNNCTCC 2 cut(s) 10, 40
Bsc4I CCNNNNNNNGG 1 cut(s) 86
BseLI CCNNNNNNNGG 1 cut(s) 86
BsiHKAI GWGCWC 1 cut(s) 112
BslI CCNNNNNNNGG 1 cut(s) 86
Bsp1286I GDGCHC 1 cut(s) 112
BstDEI CTNAG 1 cut(s) 219
Csp6I GTAC 1 cut(s) 44
CviJI RGCY 3 cut(s) 75, 110, 176
CviKI_1 RGCY 3 cut(s) 75, 110, 176
CviQI GTAC 1 cut(s) 44
DdeI CTNAG 1 cut(s) 219
Ecl136II GAGCTC 1 cut(s) 110
Eco24I GRGCYC 1 cut(s) 112
Eco53kI GAGCTC 1 cut(s) 110
EcoICRI GAGCTC 1 cut(s) 110
EcoT38I GRGCYC 1 cut(s) 112
FaiI YATR 5 cut(s) 17, 23, 42, 99, 131
FalI AAGNNNNNCTT 1 cut(s) 202
FriOI GRGCYC 1 cut(s) 112
FspBI CTAG 1 cut(s) 126
Hpy166II GTNNAC 1 cut(s) 169
Hpy188I TCNGA 1 cut(s) 12
Hpy188III TCNNGA 1 cut(s) 113
Hpy8I GTNNAC 1 cut(s) 169
HpyAV CCTTC 1 cut(s) 84
HpyCH4V TGCA 2 cut(s) 137, 215
HpyF3I CTNAG 1 cut(s) 219
LpnPI CCDG 2 cut(s) 42, 47
LweI GCATC 3 cut(s) 48, 151, 205
MaeI CTAG 1 cut(s) 126
MfeI CAATTG 1 cut(s) 150
MhlI GDGCHC 1 cut(s) 112
MluCI AATT 3 cut(s) 37, 48, 150
MseI TTAA 2 cut(s) 6, 51
MunI CAATTG 1 cut(s) 150
PshBI ATTAAT 1 cut(s) 51
Psp124BI GAGCTC 1 cut(s) 112
RsaI GTAC 1 cut(s) 45
RsaNI GTAC 1 cut(s) 44
SacI GAGCTC 1 cut(s) 112
SaqAI TTAA 2 cut(s) 6, 51
SduI GDGCHC 1 cut(s) 112
SetI ASST 2 cut(s) 112, 145
SfaNI GCATC 3 cut(s) 48, 151, 205
SgeI CNNG 7 cut(s) 41, 74, 125, 138, 170, 178, 184
SmlI CTYRAG 1 cut(s) 111
SmoI CTYRAG 1 cut(s) 111
Sse9I AATT 3 cut(s) 37, 48, 150
SspMI CTAG 1 cut(s) 126
SstI GAGCTC 1 cut(s) 112
TasI AATT 3 cut(s) 37, 48, 150
Tru1I TTAA 2 cut(s) 6, 51
Tru9I TTAA 2 cut(s) 6, 51
TspDTI ATGAA 1 cut(s) 204
VspI ATTAAT 1 cut(s) 51
XspI CTAG 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.