Rh7CG271800

RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0000747
Physical Location & Seq
Reverse (-)
27096437 .. 27098307
1871 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG271800.1

Sequence Viewer

Length: 189 bp
ATGTTTCACCAAATGCTGAGGATAAAGATGGATCTCCTAACAATGGAAGGGTGTATATATGTCAATAGAGCTCAAGATGTAGTGTCTAGTATGTTTGCAAAAAATTCAGCAATTGGACAAGATGCAGTGAACAAGGCTAAAGCATTTGATGGAAAGCATCAGTTGATAGCAAGTGATCTGAGAAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RRM_1

Protein Analysis

62

Amino Acids

6.99

Weight (kDa)

9.36

Isoelectric Point (pI)

33.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 39
AcsI RAATTY 1 cut(s) 103
AfiI CCNNNNNNNGG 1 cut(s) 43
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
Alw21I GWGCWC 1 cut(s) 73
AlwI GGATC 1 cut(s) 39
ApoI RAATTY 1 cut(s) 103
BanII GRGCYC 1 cut(s) 73
Bbv12I GWGCWC 1 cut(s) 73
BbvCI CCTCAGC 1 cut(s) 17
BccI CCATC 2 cut(s) 22, 143
BfaI CTAG 1 cut(s) 87
BmsI GCATC 2 cut(s) 112, 166
Bpu10I CCTNAGC 1 cut(s) 17
BpuEI CTTGAG 1 cut(s) 57
Bsc4I CCNNNNNNNGG 1 cut(s) 43
BseLI CCNNNNNNNGG 1 cut(s) 43
BseMII CTCAG 2 cut(s) 8, 170
BsiHKAI GWGCWC 1 cut(s) 73
BslI CCNNNNNNNGG 1 cut(s) 43
Bsp1286I GDGCHC 1 cut(s) 73
Bsp143I GATC 2 cut(s) 31, 175
BspCNI CTCAG 2 cut(s) 9, 171
BspPI GGATC 1 cut(s) 39
BssMI GATC 2 cut(s) 31, 175
BstDEI CTNAG 2 cut(s) 17, 179
BstKTI GATC 2 cut(s) 34, 178
BstMBI GATC 2 cut(s) 31, 175
BstX2I RGATCY 1 cut(s) 31
BstYI RGATCY 1 cut(s) 31
BtsI GCAGTG 1 cut(s) 132
BtsIMutI CAGTG 1 cut(s) 132
CviJI RGCY 2 cut(s) 71, 137
CviKI_1 RGCY 2 cut(s) 71, 137
DdeI CTNAG 2 cut(s) 17, 179
DpnI GATC 2 cut(s) 33, 177
DpnII GATC 2 cut(s) 31, 175
Ecl136II GAGCTC 1 cut(s) 71
Eco24I GRGCYC 1 cut(s) 73
Eco53kI GAGCTC 1 cut(s) 71
EcoICRI GAGCTC 1 cut(s) 71
EcoT38I GRGCYC 1 cut(s) 73
FaiI YATR 4 cut(s) 56, 58, 60, 92
FriOI GRGCYC 1 cut(s) 73
FspBI CTAG 1 cut(s) 87
Hpy166II GTNNAC 1 cut(s) 130
Hpy188I TCNGA 1 cut(s) 180
Hpy188III TCNNGA 1 cut(s) 74
Hpy8I GTNNAC 1 cut(s) 130
HpyAV CCTTC 1 cut(s) 41
HpyCH4V TGCA 2 cut(s) 98, 125
HpyF3I CTNAG 2 cut(s) 17, 179
Kzo9I GATC 2 cut(s) 31, 175
LweI GCATC 2 cut(s) 112, 166
MaeI CTAG 1 cut(s) 87
MalI GATC 2 cut(s) 33, 177
MboI GATC 2 cut(s) 31, 175
MfeI CAATTG 1 cut(s) 111
MflI RGATCY 1 cut(s) 31
MhlI GDGCHC 1 cut(s) 73
MluCI AATT 2 cut(s) 103, 111
MnlI CCTC 1 cut(s) 12
MunI CAATTG 1 cut(s) 111
NdeII GATC 2 cut(s) 31, 175
Psp124BI GAGCTC 1 cut(s) 73
PsuI RGATCY 1 cut(s) 31
SacI GAGCTC 1 cut(s) 73
Sau3AI GATC 2 cut(s) 31, 175
SduI GDGCHC 1 cut(s) 73
SetI ASST 1 cut(s) 73
SfaNI GCATC 2 cut(s) 112, 166
SgeI CNNG 5 cut(s) 86, 99, 131, 145, 183
SmlI CTYRAG 1 cut(s) 72
SmoI CTYRAG 1 cut(s) 72
Sse9I AATT 2 cut(s) 103, 111
SspMI CTAG 1 cut(s) 87
SstI GAGCTC 1 cut(s) 73
TasI AATT 2 cut(s) 103, 111
TscAI CASTG 1 cut(s) 132
TspRI CASTG 1 cut(s) 132
XapI RAATTY 1 cut(s) 103
XspI CTAG 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.