Rroxscaffold_4G00321400

RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain)

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
50857146 .. 50858344
1199 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00321400.1

Sequence Viewer

Length: 150 bp
ATGCCGAGGATAAAGATGGATCTCCTAACAATGGAAGGGTGTATATATGTCAATAGAGCTCAAGATGTAGTGTCTAGTATGTTTGCAAAAGGTTCAGCAATTGGACAAGATGCAGTGAACAAGGCTAAAGCATTTGATGGAAAGCATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

49

Amino Acids

5.34

Weight (kDa)

8.98

Isoelectric Point (pI)

37.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 27
AfiI CCNNNNNNNGG 1 cut(s) 31
AluBI AGCT 1 cut(s) 59
AluI AGCT 1 cut(s) 59
Alw21I GWGCWC 1 cut(s) 61
AlwI GGATC 1 cut(s) 27
BanII GRGCYC 1 cut(s) 61
Bbv12I GWGCWC 1 cut(s) 61
BccI CCATC 2 cut(s) 10, 131
BfaI CTAG 1 cut(s) 75
BmsI GCATC 1 cut(s) 100
BpuEI CTTGAG 1 cut(s) 45
BsaJI CCNNGG 1 cut(s) 5
Bsc4I CCNNNNNNNGG 1 cut(s) 31
BseDI CCNNGG 1 cut(s) 5
BseLI CCNNNNNNNGG 1 cut(s) 31
BsiHKAI GWGCWC 1 cut(s) 61
BslI CCNNNNNNNGG 1 cut(s) 31
Bsp1286I GDGCHC 1 cut(s) 61
Bsp143I GATC 1 cut(s) 19
BspPI GGATC 1 cut(s) 27
BssECI CCNNGG 1 cut(s) 5
BssMI GATC 1 cut(s) 19
BstKTI GATC 1 cut(s) 22
BstMBI GATC 1 cut(s) 19
BstX2I RGATCY 1 cut(s) 19
BstYI RGATCY 1 cut(s) 19
BtsI GCAGTG 1 cut(s) 120
BtsIMutI CAGTG 1 cut(s) 120
CviJI RGCY 2 cut(s) 59, 125
CviKI_1 RGCY 2 cut(s) 59, 125
DpnI GATC 1 cut(s) 21
DpnII GATC 1 cut(s) 19
Ecl136II GAGCTC 1 cut(s) 59
Eco24I GRGCYC 1 cut(s) 61
Eco53kI GAGCTC 1 cut(s) 59
EcoICRI GAGCTC 1 cut(s) 59
EcoT38I GRGCYC 1 cut(s) 61
FaiI YATR 4 cut(s) 44, 46, 48, 80
FriOI GRGCYC 1 cut(s) 61
FspBI CTAG 1 cut(s) 75
Hpy166II GTNNAC 1 cut(s) 118
Hpy188III TCNNGA 1 cut(s) 62
Hpy8I GTNNAC 1 cut(s) 118
HpyAV CCTTC 1 cut(s) 29
HpyCH4V TGCA 2 cut(s) 86, 113
Kzo9I GATC 1 cut(s) 19
LweI GCATC 1 cut(s) 100
MaeI CTAG 1 cut(s) 75
MalI GATC 1 cut(s) 21
MboI GATC 1 cut(s) 19
MfeI CAATTG 1 cut(s) 99
MflI RGATCY 1 cut(s) 19
MhlI GDGCHC 1 cut(s) 61
MluCI AATT 1 cut(s) 99
MunI CAATTG 1 cut(s) 99
NdeII GATC 1 cut(s) 19
NmeAIII GCCGAG 1 cut(s) 30
Psp124BI GAGCTC 1 cut(s) 61
PsuI RGATCY 1 cut(s) 19
SacI GAGCTC 1 cut(s) 61
Sau3AI GATC 1 cut(s) 19
SduI GDGCHC 1 cut(s) 61
SetI ASST 2 cut(s) 61, 94
SfaNI GCATC 1 cut(s) 100
SgeI CNNG 5 cut(s) 18, 74, 87, 119, 133
SmlI CTYRAG 1 cut(s) 60
SmoI CTYRAG 1 cut(s) 60
Sse9I AATT 1 cut(s) 99
SspMI CTAG 1 cut(s) 75
SstI GAGCTC 1 cut(s) 61
TasI AATT 1 cut(s) 99
TscAI CASTG 1 cut(s) 120
TspRI CASTG 1 cut(s) 120
XspI CTAG 1 cut(s) 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.