pycom02g13290

domain in FBox and BRCT domain containing plant proteins

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
Physical Location & Seq
Forward (+)
9803452 .. 9803967
516 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom02g13290.1

Sequence Viewer

Length: 516 bp
ATGCTCGTGTATGGCAGAGATTCACAACTAGAAGTCACTGGATATACTGATTCAGATTTGGCTGGAGACTTGGATGAAAGAAAATCCACTGGTGGCTATGTCTTTATGCTTGGAGGTGGAGCTATTTCATGGCAGAGTTCTAAGCAGTCTATTATAACAACATCTACCATGGAAGCAGAATTTGTAGCATGTTTTGAAGGCAGCAAGCAAGCTATTTGGCTCAGGAATTTCATAAGTGAGTTAAAGATAATGGATTCAATTCAAAAACCGATGAAGATGTTTTGTGACAATATTTCGGCTGTGTTTTTCTCTAAAAACAATAAGAGGACTTCTGCTAGTAGACTGATGGATGTAAAATGTCTGAAAGTTCGAGAAATGGTGAAGGAAGGAGCTATAGAAGTACAACATCTGAATACAAATCTCATGGTTGCAGATCCTTTGACTAAAGCTTTACCATTTGGAGTTTTCAAAGCTCATGTTACTCGAATGGGAGTGCTGGAATCTTTTGATCAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

172

Amino Acids

19.08

Weight (kDa)

6.73

Isoelectric Point (pI)

36.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 155
AccI GTMKAC 1 cut(s) 340
AclWI GGATC 1 cut(s) 428
AcsI RAATTY 2 cut(s) 179, 226
AfaI GTAC 1 cut(s) 402
AgsI TTSAA 4 cut(s) 197, 258, 263, 469
AluBI AGCT 5 cut(s) 122, 212, 392, 449, 473
AluI AGCT 5 cut(s) 122, 212, 392, 449, 473
Alw26I GTCTC 1 cut(s) 60
AlwI GGATC 1 cut(s) 428
ApeKI GCWGC 1 cut(s) 201
ApoI RAATTY 2 cut(s) 179, 226
AsuHPI GGTGA 1 cut(s) 391
BauI CACGAG 1 cut(s) 5
BbvI GCAGC 1 cut(s) 213
BccI CCATC 1 cut(s) 340
BclI TGATCA 1 cut(s) 508
BcoDI GTCTC 1 cut(s) 60
BfaI CTAG 2 cut(s) 29, 336
BfmI CTRYAG 1 cut(s) 393
BisI GCNGC 1 cut(s) 202
BlsI GCNGC 1 cut(s) 203
BpmI CTGGAG 1 cut(s) 84
Bpu10I CCTNAGC 1 cut(s) 221
BsaJI CCNNGG 1 cut(s) 168
Bse1I ACTGG 2 cut(s) 43, 94
BseDI CCNNGG 1 cut(s) 168
BseGI GGATG 2 cut(s) 79, 355
BseMII CTCAG 1 cut(s) 235
BseNI ACTGG 2 cut(s) 43, 94
BseXI GCAGC 1 cut(s) 213
BsmAI GTCTC 1 cut(s) 60
Bsp143I GATC 2 cut(s) 433, 508
Bsp19I CCATGG 1 cut(s) 168
BspCNI CTCAG 1 cut(s) 234
BspPI GGATC 1 cut(s) 428
BsrI ACTGG 2 cut(s) 43, 94
BssECI CCNNGG 1 cut(s) 168
BssMI GATC 2 cut(s) 433, 508
BssSI CACGAG 1 cut(s) 5
BssT1I CCWWGG 1 cut(s) 168
Bst2BI CACGAG 1 cut(s) 5
BstC8I GCNNGC 2 cut(s) 206, 210
BstDEI CTNAG 2 cut(s) 141, 221
BstDSI CCRYGG 1 cut(s) 168
BstF5I GGATG 2 cut(s) 79, 355
BstKTI GATC 2 cut(s) 436, 511
BstMAI GTCTC 1 cut(s) 60
BstMBI GATC 2 cut(s) 433, 508
BstNSI RCATGY 1 cut(s) 192
BstSFI CTRYAG 1 cut(s) 393
BstV1I GCAGC 1 cut(s) 213
BstX2I RGATCY 1 cut(s) 433
BstYI RGATCY 1 cut(s) 433
BtgI CCRYGG 1 cut(s) 168
BtsCI GGATG 2 cut(s) 79, 355
BtsIMutI CAGTG 2 cut(s) 36, 87
Cac8I GCNNGC 2 cut(s) 206, 210
Csp6I GTAC 1 cut(s) 401
CviAII CATG 5 cut(s) 129, 169, 189, 424, 476
CviJI RGCY 9 cut(s) 62, 96, 122, 212, 220, 299, 392, 449, 473
CviKI_1 RGCY 9 cut(s) 62, 96, 122, 212, 220, 299, 392, 449, 473
CviQI GTAC 1 cut(s) 401
DdeI CTNAG 2 cut(s) 141, 221
DpnI GATC 2 cut(s) 435, 510
DpnII GATC 2 cut(s) 433, 508
Eco130I CCWWGG 1 cut(s) 168
EcoT14I CCWWGG 1 cut(s) 168
ErhI CCWWGG 1 cut(s) 168
FaeI CATG 5 cut(s) 132, 172, 192, 427, 479
FatI CATG 5 cut(s) 128, 168, 188, 423, 475
FbaI TGATCA 1 cut(s) 508
FblI GTMKAC 1 cut(s) 340
Fnu4HI GCNGC 1 cut(s) 202
FokI GGATG 2 cut(s) 86, 362
Fsp4HI GCNGC 1 cut(s) 202
FspBI CTAG 2 cut(s) 29, 336
GluI GCNGC 1 cut(s) 202
GsuI CTGGAG 1 cut(s) 84
Hin1II CATG 5 cut(s) 132, 172, 192, 427, 479
HindIII AAGCTT 1 cut(s) 447
HinfI GANTC 4 cut(s) 20, 50, 254, 500
HphI GGTGA 1 cut(s) 391
Hpy166II GTNNAC 1 cut(s) 341
Hpy188I TCNGA 3 cut(s) 55, 363, 411
Hpy188III TCNNGA 2 cut(s) 223, 371
Hpy8I GTNNAC 1 cut(s) 341
HpyAV CCTTC 3 cut(s) 191, 376, 380
HpyCH4V TGCA 1 cut(s) 431
HpyF3I CTNAG 2 cut(s) 141, 221
Hsp92II CATG 5 cut(s) 132, 172, 192, 427, 479
Ksp22I TGATCA 1 cut(s) 508
Kzo9I GATC 2 cut(s) 433, 508
LmnI GCTCC 2 cut(s) 119, 389
LpnPI CCDG 5 cut(s) 24, 48, 75, 208, 482
Lsp1109I GCAGC 1 cut(s) 213
MaeI CTAG 2 cut(s) 29, 336
MaeIII GTNAC 3 cut(s) 34, 284, 478
MalI GATC 2 cut(s) 435, 510
MboI GATC 2 cut(s) 433, 508
MboII GAAGA 1 cut(s) 286
MflI RGATCY 1 cut(s) 433
MluCI AATT 3 cut(s) 179, 226, 258
MnlI CCTC 2 cut(s) 107, 318
MseI TTAA 1 cut(s) 242
NcoI CCATGG 1 cut(s) 168
NdeII GATC 2 cut(s) 433, 508
NlaIII CATG 5 cut(s) 132, 172, 192, 427, 479
NmuCI GTSAC 2 cut(s) 34, 284
NspI RCATGY 1 cut(s) 192
PfeI GAWTC 4 cut(s) 20, 50, 254, 500
PkrI GCNGC 1 cut(s) 203
PsiI TTATAA 1 cut(s) 155
PsuI RGATCY 1 cut(s) 433
RsaI GTAC 1 cut(s) 402
RsaNI GTAC 1 cut(s) 401
SaqAI TTAA 1 cut(s) 242
SatI GCNGC 1 cut(s) 202
Sau3AI GATC 2 cut(s) 433, 508
SetI ASST 6 cut(s) 118, 124, 214, 394, 451, 475
SfcI CTRYAG 1 cut(s) 393
Sse9I AATT 3 cut(s) 179, 226, 258
SspI AATATT 1 cut(s) 292
SspMI CTAG 2 cut(s) 29, 336
StyI CCWWGG 1 cut(s) 168
TaqI TCGA 2 cut(s) 370, 484
TasI AATT 3 cut(s) 179, 226, 258
TatI WGTACW 1 cut(s) 400
TfiI GAWTC 4 cut(s) 20, 50, 254, 500
Tru1I TTAA 1 cut(s) 242
Tru9I TTAA 1 cut(s) 242
TscAI CASTG 2 cut(s) 43, 94
TseFI GTSAC 2 cut(s) 34, 284
TseI GCWGC 1 cut(s) 201
Tsp45I GTSAC 2 cut(s) 34, 284
TspDTI ATGAA 4 cut(s) 90, 117, 220, 287
TspRI CASTG 2 cut(s) 43, 94
XapI RAATTY 2 cut(s) 179, 226
XceI RCATGY 1 cut(s) 192
XmiI GTMKAC 1 cut(s) 340
XspI CTAG 2 cut(s) 29, 336
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.