RchiOBHm_Chr7g0192701

beta-1,3-galactosyltransferase 3

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0001006
Physical Location & Seq
Forward (+)
11113121 .. 11113546
426 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ17227

Sequence Viewer

Length: 351 bp
ATGCAAGCTGAATTTATTGCAGTATATGAAACTGTGTGTGAAGGACTTTGGATTCGAAATTTTCTCATGCAGACCAAAGTATTGAGTCACATTGTGGCTGGAACACTTGTAATTTATTGTGACAATGAGGCTGCAGTTTTCTTTAGCAAAAACAGTAAAAGGTCAAATAATTCTAAACACATTGATCTAAAGTATTACAGTGTTAGAGAAAGAGTAAAGCATGGTGAAATAGTTGTTTTGAGTATTGACACAAATTCACAGCTAGCAGATCCCTTCACCAAGGCCTTGTCAGTAGCAGCATTCCAGAAGCATACAACAAGCATTGGAGTTTTAGCTAATCTAGATGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4094 Galactosyl_T

Protein Analysis

116

Amino Acids

12.98

Weight (kDa)

7.81

Isoelectric Point (pI)

21.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 263
AcsI RAATTY 3 cut(s) 11, 58, 253
AdeI CACNNNGTG 1 cut(s) 94
AluBI AGCT 3 cut(s) 8, 262, 335
AluI AGCT 3 cut(s) 8, 262, 335
AlwI GGATC 1 cut(s) 263
AoxI GGCC 1 cut(s) 282
ApeKI GCWGC 2 cut(s) 131, 296
ApoI RAATTY 3 cut(s) 11, 58, 253
ArsI GACNNNNNNTTYG 2 cut(s) 36, 68
AsuHPI GGTGA 2 cut(s) 236, 268
AsuII TTCGAA 1 cut(s) 55
AsuNHI GCTAGC 1 cut(s) 262
BbvI GCAGC 2 cut(s) 118, 308
BfaI CTAG 2 cut(s) 263, 341
BfmI CTRYAG 1 cut(s) 132
BisI GCNGC 2 cut(s) 132, 297
BlsI GCNGC 2 cut(s) 133, 298
BmsI GCATC 1 cut(s) 334
BmtI GCTAGC 1 cut(s) 266
Bpu14I TTCGAA 1 cut(s) 55
BsaJI CCNNGG 1 cut(s) 279
BseDI CCNNGG 1 cut(s) 279
BseXI GCAGC 2 cut(s) 118, 308
BshFI GGCC 1 cut(s) 284
BsmI GAATGC 1 cut(s) 299
BsnI GGCC 1 cut(s) 284
Bsp119I TTCGAA 1 cut(s) 55
Bsp143I GATC 2 cut(s) 184, 268
BspANI GGCC 1 cut(s) 284
BspMAI CTGCAG 1 cut(s) 136
BspOI GCTAGC 1 cut(s) 266
BspPI GGATC 1 cut(s) 263
BspT104I TTCGAA 1 cut(s) 55
BssECI CCNNGG 1 cut(s) 279
BssMI GATC 2 cut(s) 184, 268
BssT1I CCWWGG 1 cut(s) 279
Bst4CI ACNGT 3 cut(s) 34, 155, 200
BstBI TTCGAA 1 cut(s) 55
BstC8I GCNNGC 2 cut(s) 6, 264
BstDEI CTNAG 1 cut(s) 348
BstKTI GATC 2 cut(s) 187, 271
BstMBI GATC 2 cut(s) 184, 268
BstSFI CTRYAG 1 cut(s) 132
BstV1I GCAGC 2 cut(s) 118, 308
BstX2I RGATCY 1 cut(s) 268
BstYI RGATCY 1 cut(s) 268
BsuRI GGCC 1 cut(s) 284
BtsIMutI CAGTG 1 cut(s) 205
Cac8I GCNNGC 2 cut(s) 6, 264
CviAII CATG 2 cut(s) 67, 221
CviJI RGCY 6 cut(s) 8, 98, 131, 262, 284, 335
CviKI_1 RGCY 6 cut(s) 8, 98, 131, 262, 284, 335
DdeI CTNAG 1 cut(s) 348
DpnI GATC 2 cut(s) 186, 270
DpnII GATC 2 cut(s) 184, 268
DraIII CACNNNGTG 1 cut(s) 94
Eco130I CCWWGG 1 cut(s) 279
Eco147I AGGCCT 1 cut(s) 284
EcoT14I CCWWGG 1 cut(s) 279
ErhI CCWWGG 1 cut(s) 279
FaeI CATG 2 cut(s) 70, 224
FaiI YATR 5 cut(s) 25, 27, 68, 222, 312
FatI CATG 2 cut(s) 66, 220
Fnu4HI GCNGC 2 cut(s) 132, 297
Fsp4HI GCNGC 2 cut(s) 132, 297
FspBI CTAG 2 cut(s) 263, 341
GluI GCNGC 2 cut(s) 132, 297
HaeIII GGCC 1 cut(s) 284
Hin1II CATG 2 cut(s) 70, 224
HinfI GANTC 2 cut(s) 52, 85
HphI GGTGA 2 cut(s) 236, 268
Hpy188III TCNNGA 2 cut(s) 304, 341
HpyAV CCTTC 2 cut(s) 35, 283
HpyCH4III ACNGT 3 cut(s) 34, 155, 200
HpyCH4V TGCA 4 cut(s) 4, 20, 70, 134
HpyF3I CTNAG 1 cut(s) 348
Hsp92II CATG 2 cut(s) 70, 224
Kzo9I GATC 2 cut(s) 184, 268
LpnPI CCDG 2 cut(s) 84, 317
Lsp1109I GCAGC 2 cut(s) 118, 308
LweI GCATC 1 cut(s) 334
MaeI CTAG 2 cut(s) 263, 341
MaeIII GTNAC 2 cut(s) 86, 119
MalI GATC 2 cut(s) 186, 270
MboI GATC 2 cut(s) 184, 268
MflI RGATCY 1 cut(s) 268
MluCI AATT 5 cut(s) 11, 58, 111, 169, 253
MlyI GAGTC 1 cut(s) 94
MnlI CCTC 1 cut(s) 121
Mva1269I GAATGC 1 cut(s) 299
NdeII GATC 2 cut(s) 184, 268
NheI GCTAGC 1 cut(s) 262
NlaIII CATG 2 cut(s) 70, 224
NmuCI GTSAC 2 cut(s) 86, 119
NspV TTCGAA 1 cut(s) 55
PceI AGGCCT 1 cut(s) 284
PctI GAATGC 1 cut(s) 299
PfeI GAWTC 1 cut(s) 52
PkrI GCNGC 2 cut(s) 133, 298
PleI GAGTC 1 cut(s) 93
PpsI GAGTC 1 cut(s) 93
PstI CTGCAG 1 cut(s) 136
PsuI RGATCY 1 cut(s) 268
SatI GCNGC 2 cut(s) 132, 297
Sau3AI GATC 2 cut(s) 184, 268
SchI GAGTC 1 cut(s) 94
SetI ASST 4 cut(s) 10, 164, 264, 337
SfaNI GCATC 1 cut(s) 334
SfcI CTRYAG 1 cut(s) 132
SfuI TTCGAA 1 cut(s) 55
Sse9I AATT 5 cut(s) 11, 58, 111, 169, 253
SseBI AGGCCT 1 cut(s) 284
SspMI CTAG 2 cut(s) 263, 341
StuI AGGCCT 1 cut(s) 284
StyI CCWWGG 1 cut(s) 279
TaaI ACNGT 3 cut(s) 34, 155, 200
TaqI TCGA 1 cut(s) 55
TasI AATT 5 cut(s) 11, 58, 111, 169, 253
TfiI GAWTC 1 cut(s) 52
TscAI CASTG 1 cut(s) 205
TseFI GTSAC 2 cut(s) 86, 119
TseI GCWGC 2 cut(s) 131, 296
Tsp45I GTSAC 2 cut(s) 86, 119
TspDTI ATGAA 1 cut(s) 42
TspRI CASTG 1 cut(s) 205
XapI RAATTY 3 cut(s) 11, 58, 253
XbaI TCTAGA 1 cut(s) 340
XspI CTAG 2 cut(s) 263, 341
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.