RchiOBHm_Chr5g0040891

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0001006
Physical Location & Seq
Reverse (-)
35502126 .. 35502448
323 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31936

Sequence Viewer

Length: 276 bp
ATGAAAGTGGTGGATTCAATTGAAAGGCCATTGACCATTTACTGTGACAATGCAGCTGCTGTGTTCTTTTCAAAGAACAACAAAAGGACTTCTGGATCTAGAAACATTGATGTTAAGTATTTCTCTGTGAGAGAAAGTGTGAGAGACAATGAAGTAGAGGTGACCAAAATAGGTACAAAAGACCAACTTGCAGATCCATTGACCAAAGCATTGCCAGTTTCTGTGTTCATCAGACATGTGGAAAATATGGGAGTTTTAGGCAGTATTGATGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.1

Weight (kDa)

7.87

Isoelectric Point (pI)

37.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 103, 188
AfaI GTAC 1 cut(s) 175
AflIII ACRYGT 1 cut(s) 235
AgsI TTSAA 3 cut(s) 18, 23, 72
AluBI AGCT 1 cut(s) 56
AluI AGCT 1 cut(s) 56
Alw26I GTCTC 1 cut(s) 138
AlwI GGATC 2 cut(s) 103, 188
AlwNI CAGNNNCTG 2 cut(s) 59, 221
AoxI GGCC 1 cut(s) 26
ApeKI GCWGC 2 cut(s) 53, 56
AsuHPI GGTGA 1 cut(s) 172
BbvI GCAGC 2 cut(s) 43, 65
BccI CCATC 1 cut(s) 263
BcoDI GTCTC 1 cut(s) 138
BfaI CTAG 1 cut(s) 99
BisI GCNGC 2 cut(s) 54, 57
BlsI GCNGC 2 cut(s) 55, 58
Bse1I ACTGG 1 cut(s) 215
Bse3DI GCAATG 1 cut(s) 209
BseMI GCAATG 1 cut(s) 209
BseNI ACTGG 1 cut(s) 215
BseXI GCAGC 2 cut(s) 43, 65
BshFI GGCC 1 cut(s) 28
BsmAI GTCTC 1 cut(s) 138
BsnI GGCC 1 cut(s) 28
Bsp143I GATC 2 cut(s) 95, 193
BspANI GGCC 1 cut(s) 28
BspPI GGATC 2 cut(s) 103, 188
BsrDI GCAATG 1 cut(s) 209
BsrI ACTGG 1 cut(s) 215
BssMI GATC 2 cut(s) 95, 193
Bst4CI ACNGT 1 cut(s) 44
BstEII GGTNACC 1 cut(s) 160
BstKTI GATC 2 cut(s) 98, 196
BstMAI GTCTC 1 cut(s) 138
BstMBI GATC 2 cut(s) 95, 193
BstNSI RCATGY 1 cut(s) 239
BstPI GGTNACC 1 cut(s) 160
BstV1I GCAGC 2 cut(s) 43, 65
BstX2I RGATCY 2 cut(s) 95, 193
BstYI RGATCY 2 cut(s) 95, 193
BsuRI GGCC 1 cut(s) 28
CaiI CAGNNNCTG 2 cut(s) 59, 221
Csp6I GTAC 1 cut(s) 174
CviAII CATG 1 cut(s) 236
CviJI RGCY 2 cut(s) 28, 56
CviKI_1 RGCY 2 cut(s) 28, 56
CviQI GTAC 1 cut(s) 174
DpnI GATC 2 cut(s) 97, 195
DpnII GATC 2 cut(s) 95, 193
Eco91I GGTNACC 1 cut(s) 160
EcoO65I GGTNACC 1 cut(s) 160
FaeI CATG 1 cut(s) 239
FaiI YATR 2 cut(s) 237, 248
FalI AAGNNNNNCTT 2 cut(s) 171, 203
FatI CATG 1 cut(s) 235
Fnu4HI GCNGC 2 cut(s) 54, 57
Fsp4HI GCNGC 2 cut(s) 54, 57
FspBI CTAG 1 cut(s) 99
GluI GCNGC 2 cut(s) 54, 57
HaeIII GGCC 1 cut(s) 28
Hin1II CATG 1 cut(s) 239
HinfI GANTC 1 cut(s) 14
HphI GGTGA 1 cut(s) 172
Hpy188I TCNGA 1 cut(s) 233
Hpy188III TCNNGA 2 cut(s) 93, 99
HpyCH4III ACNGT 1 cut(s) 44
HpyCH4V TGCA 2 cut(s) 53, 191
Hsp92II CATG 1 cut(s) 239
Kzo9I GATC 2 cut(s) 95, 193
LpnPI CCDG 2 cut(s) 78, 228
Lsp1109I GCAGC 2 cut(s) 43, 65
MaeI CTAG 1 cut(s) 99
MaeIII GTNAC 2 cut(s) 44, 160
MalI GATC 2 cut(s) 97, 195
MboI GATC 2 cut(s) 95, 193
MfeI CAATTG 1 cut(s) 18
MflI RGATCY 2 cut(s) 95, 193
MluCI AATT 1 cut(s) 18
MnlI CCTC 1 cut(s) 151
MseI TTAA 1 cut(s) 114
MspA1I CMGCKG 1 cut(s) 56
MunI CAATTG 1 cut(s) 18
NdeII GATC 2 cut(s) 95, 193
NlaIII CATG 1 cut(s) 239
NmuCI GTSAC 2 cut(s) 44, 160
NspI RCATGY 1 cut(s) 239
PciI ACATGT 1 cut(s) 235
PfeI GAWTC 1 cut(s) 14
PkrI GCNGC 2 cut(s) 55, 58
PscI ACATGT 1 cut(s) 235
PspEI GGTNACC 1 cut(s) 160
PstNI CAGNNNCTG 2 cut(s) 59, 221
PsuI RGATCY 2 cut(s) 95, 193
PvuII CAGCTG 1 cut(s) 56
RsaI GTAC 1 cut(s) 175
RsaNI GTAC 1 cut(s) 174
SaqAI TTAA 1 cut(s) 114
SatI GCNGC 2 cut(s) 54, 57
Sau3AI GATC 2 cut(s) 95, 193
SetI ASST 3 cut(s) 58, 162, 175
SgeI CNNG 5 cut(s) 105, 111, 200, 227, 248
Sse9I AATT 1 cut(s) 18
SspMI CTAG 1 cut(s) 99
TaaI ACNGT 1 cut(s) 44
TasI AATT 1 cut(s) 18
TfiI GAWTC 1 cut(s) 14
Tru1I TTAA 1 cut(s) 114
Tru9I TTAA 1 cut(s) 114
TseFI GTSAC 2 cut(s) 44, 160
TseI GCWGC 2 cut(s) 53, 56
Tsp45I GTSAC 2 cut(s) 44, 160
TspDTI ATGAA 3 cut(s) 17, 165, 217
XbaI TCTAGA 1 cut(s) 98
XceI RCATGY 1 cut(s) 239
XspI CTAG 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.