RchiOBHm_Chr3g0495711

beta-1,3-galactosyltransferase 3

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
45650248 .. 45650631
384 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ45809

Sequence Viewer

Length: 381 bp
ATGAAACAAACACTTGTTTCAACTTCTACTATGCAAGCTGAATTTATTGCAGTATATGAAACTGTGTGTGAAGGACTTTGGATTAGGAATTTTCTCATGCAGACCAAAGTATTGAGTCACATTGTGGCTGGAACACTTGTAATTTATTGTGACAATGAGGCTGCAGTTTTCTTTAGCAAGAACAGTAAAAGGTCAAATAATTCCAAGCATATTGATCTAAAGTATTACAGTGTTAGAGAAAGAGTAAAGCATGGTGAAATAGCTGTTTTGAGTATTGACACAAATTCACAGCTAGCAGATCCTTTCACCAAGGCATTGTCAGTAGCAGCATTCCAGAAACATACAGCAAGCATTGGAATTTTAGCTAATTTAGATGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

126

Amino Acids

14.01

Weight (kDa)

8.58

Isoelectric Point (pI)

24.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 293
AcsI RAATTY 4 cut(s) 41, 88, 283, 357
AdeI CACNNNGTG 1 cut(s) 124
AgsI TTSAA 1 cut(s) 21
AluBI AGCT 4 cut(s) 38, 263, 292, 365
AluI AGCT 4 cut(s) 38, 263, 292, 365
AlwI GGATC 1 cut(s) 293
ApeKI GCWGC 2 cut(s) 161, 326
ApoI RAATTY 4 cut(s) 41, 88, 283, 357
AsuHPI GGTGA 2 cut(s) 266, 298
AsuNHI GCTAGC 1 cut(s) 292
BbvI GCAGC 2 cut(s) 148, 338
BfaI CTAG 1 cut(s) 293
BfmI CTRYAG 1 cut(s) 162
BisI GCNGC 2 cut(s) 162, 327
BlsI GCNGC 2 cut(s) 163, 328
BmsI GCATC 1 cut(s) 364
BmtI GCTAGC 1 cut(s) 296
BsaJI CCNNGG 1 cut(s) 309
BseDI CCNNGG 1 cut(s) 309
BseXI GCAGC 2 cut(s) 148, 338
BsmI GAATGC 1 cut(s) 329
Bsp143I GATC 2 cut(s) 214, 298
BspMAI CTGCAG 1 cut(s) 166
BspOI GCTAGC 1 cut(s) 296
BspPI GGATC 1 cut(s) 293
BssECI CCNNGG 1 cut(s) 309
BssMI GATC 2 cut(s) 214, 298
BssT1I CCWWGG 1 cut(s) 309
Bst4CI ACNGT 3 cut(s) 64, 185, 230
BstC8I GCNNGC 3 cut(s) 36, 294, 349
BstDEI CTNAG 1 cut(s) 378
BstKTI GATC 2 cut(s) 217, 301
BstMBI GATC 2 cut(s) 214, 298
BstSFI CTRYAG 1 cut(s) 162
BstV1I GCAGC 2 cut(s) 148, 338
BstX2I RGATCY 1 cut(s) 298
BstYI RGATCY 1 cut(s) 298
BtsIMutI CAGTG 1 cut(s) 235
Cac8I GCNNGC 3 cut(s) 36, 294, 349
CviAII CATG 2 cut(s) 97, 251
CviJI RGCY 6 cut(s) 38, 128, 161, 263, 292, 365
CviKI_1 RGCY 6 cut(s) 38, 128, 161, 263, 292, 365
DdeI CTNAG 1 cut(s) 378
DpnI GATC 2 cut(s) 216, 300
DpnII GATC 2 cut(s) 214, 298
DraIII CACNNNGTG 1 cut(s) 124
Eco130I CCWWGG 1 cut(s) 309
EcoT14I CCWWGG 1 cut(s) 309
ErhI CCWWGG 1 cut(s) 309
FaeI CATG 2 cut(s) 100, 254
FaiI YATR 7 cut(s) 32, 55, 57, 98, 210, 252, 342
FatI CATG 2 cut(s) 96, 250
Fnu4HI GCNGC 2 cut(s) 162, 327
Fsp4HI GCNGC 2 cut(s) 162, 327
FspBI CTAG 1 cut(s) 293
GluI GCNGC 2 cut(s) 162, 327
Hin1II CATG 2 cut(s) 100, 254
HinfI GANTC 1 cut(s) 115
HphI GGTGA 2 cut(s) 266, 298
Hpy188III TCNNGA 1 cut(s) 334
HpyAV CCTTC 1 cut(s) 65
HpyCH4III ACNGT 3 cut(s) 64, 185, 230
HpyCH4V TGCA 4 cut(s) 34, 50, 100, 164
HpyF3I CTNAG 1 cut(s) 378
Hsp92II CATG 2 cut(s) 100, 254
Kzo9I GATC 2 cut(s) 214, 298
LpnPI CCDG 2 cut(s) 114, 347
Lsp1109I GCAGC 2 cut(s) 148, 338
LweI GCATC 1 cut(s) 364
MaeI CTAG 1 cut(s) 293
MaeIII GTNAC 2 cut(s) 116, 149
MalI GATC 2 cut(s) 216, 300
MboI GATC 2 cut(s) 214, 298
MflI RGATCY 1 cut(s) 298
MluCI AATT 7 cut(s) 41, 88, 141, 199, 283, 357, 367
MlyI GAGTC 1 cut(s) 124
MnlI CCTC 1 cut(s) 151
Mva1269I GAATGC 1 cut(s) 329
NdeII GATC 2 cut(s) 214, 298
NheI GCTAGC 1 cut(s) 292
NlaIII CATG 2 cut(s) 100, 254
NmuCI GTSAC 2 cut(s) 116, 149
PctI GAATGC 1 cut(s) 329
PkrI GCNGC 2 cut(s) 163, 328
PleI GAGTC 1 cut(s) 123
PpsI GAGTC 1 cut(s) 123
PstI CTGCAG 1 cut(s) 166
PsuI RGATCY 1 cut(s) 298
SatI GCNGC 2 cut(s) 162, 327
Sau3AI GATC 2 cut(s) 214, 298
SchI GAGTC 1 cut(s) 124
SetI ASST 5 cut(s) 40, 194, 265, 294, 367
SfaNI GCATC 1 cut(s) 364
SfcI CTRYAG 1 cut(s) 162
Sse9I AATT 7 cut(s) 41, 88, 141, 199, 283, 357, 367
SspMI CTAG 1 cut(s) 293
StyI CCWWGG 1 cut(s) 309
TaaI ACNGT 3 cut(s) 64, 185, 230
TasI AATT 7 cut(s) 41, 88, 141, 199, 283, 357, 367
TscAI CASTG 1 cut(s) 235
TseFI GTSAC 2 cut(s) 116, 149
TseI GCWGC 2 cut(s) 161, 326
Tsp45I GTSAC 2 cut(s) 116, 149
TspDTI ATGAA 2 cut(s) 17, 72
TspRI CASTG 1 cut(s) 235
XapI RAATTY 4 cut(s) 41, 88, 283, 357
XspI CTAG 1 cut(s) 293
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.