pycom15g38160

Mitochondrial protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Reverse (-)
38043738 .. 38044106
369 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g38160.1

Sequence Viewer

Length: 369 bp
ATGATTCTAGCTTTGGCAGGAATAAAGCATTGGGATCTTAGACAACTTGATATCAAAAATGCATTTCTACATGGTGATTTACAAGAGGAGGTGCTTATGAAACAACCTAAGGGATTTGTAGATGCATCTCATCCTACATATGTGTGCAAGTTAATTAAATCCTTGTATGGATTAAAGCAAGCCCCAAGGGCATGGAATTCTAAGTTCACTAGTTATTTGACAGCTCTACAGTTTGCTGCTTCATCATCTAATGCAAGTTTATTTGTTAAAACAGATGGCCTAGATATGACAATTCTATTACTCTATGTGGATGACATCATTCTCACAGATAAACTTCATCATCTGCTATGTTTGAGCTTAAAGATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

123

Amino Acids

13.75

Weight (kDa)

8.55

Isoelectric Point (pI)

26.34

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_2 PF07727 2 - 111 6.8e-32 Reverse transcriptase (RNA-dependent DNA polymerase)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 42
AcsI RAATTY 1 cut(s) 196
AhlI ACTAGT 1 cut(s) 209
AjuI GAANNNNNNNTTGG 2 cut(s) 13, 45
AluBI AGCT 3 cut(s) 11, 224, 357
AluI AGCT 3 cut(s) 11, 224, 357
AlwI GGATC 1 cut(s) 42
AoxI GGCC 1 cut(s) 277
ApeKI GCWGC 1 cut(s) 236
ApoI RAATTY 1 cut(s) 196
AsuHPI GGTGA 1 cut(s) 86
AxyI CCTNAGG 1 cut(s) 108
BbvI GCAGC 1 cut(s) 223
BccI CCATC 1 cut(s) 269
BcuI ACTAGT 1 cut(s) 209
BfaI CTAG 3 cut(s) 8, 210, 281
BfmI CTRYAG 1 cut(s) 227
BglI GCCNNNNNGGC 1 cut(s) 188
BisI GCNGC 1 cut(s) 237
BlsI GCNGC 1 cut(s) 238
BmsI GCATC 2 cut(s) 112, 134
BsaJI CCNNGG 1 cut(s) 185
Bse21I CCTNAGG 1 cut(s) 108
BseDI CCNNGG 1 cut(s) 185
BseGI GGATG 2 cut(s) 130, 316
BseRI GAGGAG 1 cut(s) 101
BseXI GCAGC 1 cut(s) 223
BshFI GGCC 1 cut(s) 279
BsnI GGCC 1 cut(s) 279
Bsp143I GATC 1 cut(s) 34
BspANI GGCC 1 cut(s) 279
BspPI GGATC 1 cut(s) 42
BssECI CCNNGG 1 cut(s) 185
BssMI GATC 1 cut(s) 34
BssT1I CCWWGG 1 cut(s) 185
Bst4CI ACNGT 1 cut(s) 231
BstC8I GCNNGC 1 cut(s) 180
BstDEI CTNAG 3 cut(s) 38, 108, 201
BstF5I GGATG 2 cut(s) 130, 316
BstKTI GATC 1 cut(s) 37
BstMBI GATC 1 cut(s) 34
BstMWI GCNNNNNNNGC 1 cut(s) 188
BstSFI CTRYAG 1 cut(s) 227
BstV1I GCAGC 1 cut(s) 223
BstX2I RGATCY 1 cut(s) 34
BstXI CCANNNNNNTGG 1 cut(s) 192
BstYI RGATCY 1 cut(s) 34
Bsu36I CCTNAGG 1 cut(s) 108
BsuRI GGCC 1 cut(s) 279
BtsCI GGATG 2 cut(s) 130, 316
Cac8I GCNNGC 1 cut(s) 180
CviAII CATG 2 cut(s) 71, 192
CviJI RGCY 5 cut(s) 11, 182, 224, 279, 357
CviKI_1 RGCY 5 cut(s) 11, 182, 224, 279, 357
DdeI CTNAG 3 cut(s) 38, 108, 201
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
Eco130I CCWWGG 1 cut(s) 185
Eco32I GATATC 1 cut(s) 52
Eco81I CCTNAGG 1 cut(s) 108
EcoRI GAATTC 1 cut(s) 196
EcoRV GATATC 1 cut(s) 52
EcoT14I CCWWGG 1 cut(s) 185
EcoT22I ATGCAT 2 cut(s) 64, 127
ErhI CCWWGG 1 cut(s) 185
FaeI CATG 2 cut(s) 74, 195
FatI CATG 2 cut(s) 70, 191
FauNDI CATATG 1 cut(s) 139
Fnu4HI GCNGC 1 cut(s) 237
FokI GGATG 2 cut(s) 117, 323
Fsp4HI GCNGC 1 cut(s) 237
FspBI CTAG 3 cut(s) 8, 210, 281
GluI GCNGC 1 cut(s) 237
HaeIII GGCC 1 cut(s) 279
Hin1II CATG 2 cut(s) 74, 195
HinfI GANTC 1 cut(s) 4
HphI GGTGA 1 cut(s) 86
Hpy166II GTNNAC 1 cut(s) 207
Hpy8I GTNNAC 1 cut(s) 207
HpyCH4III ACNGT 1 cut(s) 231
HpyCH4V TGCA 4 cut(s) 62, 125, 147, 254
HpyF10VI GCNNNNNNNGC 1 cut(s) 188
HpyF3I CTNAG 3 cut(s) 38, 108, 201
Hsp92II CATG 2 cut(s) 74, 195
Kzo9I GATC 1 cut(s) 34
LpnPI CCDG 1 cut(s) 3
Lsp1109I GCAGC 1 cut(s) 223
LweI GCATC 2 cut(s) 112, 134
MaeI CTAG 3 cut(s) 8, 210, 281
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MflI RGATCY 1 cut(s) 34
MluCI AATT 3 cut(s) 153, 196, 291
MnlI CCTC 2 cut(s) 79, 82
Mph1103I ATGCAT 2 cut(s) 64, 127
MseI TTAA 5 cut(s) 152, 156, 173, 267, 359
MslI CAYNNNNRTG 1 cut(s) 142
MwoI GCNNNNNNNGC 1 cut(s) 188
NdeI CATATG 1 cut(s) 139
NdeII GATC 1 cut(s) 34
NlaIII CATG 2 cut(s) 74, 195
NsiI ATGCAT 2 cut(s) 64, 127
PacI TTAATTAA 1 cut(s) 156
PfeI GAWTC 1 cut(s) 4
PkrI GCNGC 1 cut(s) 238
PsuI RGATCY 1 cut(s) 34
RseI CAYNNNNRTG 1 cut(s) 142
SaqAI TTAA 5 cut(s) 152, 156, 173, 267, 359
SatI GCNGC 1 cut(s) 237
Sau3AI GATC 1 cut(s) 34
SetI ASST 5 cut(s) 13, 93, 109, 226, 359
SfaNI GCATC 2 cut(s) 112, 134
SfcI CTRYAG 1 cut(s) 227
SmiMI CAYNNNNRTG 1 cut(s) 142
SpeI ACTAGT 1 cut(s) 209
Sse9I AATT 3 cut(s) 153, 196, 291
SspMI CTAG 3 cut(s) 8, 210, 281
StyI CCWWGG 1 cut(s) 185
TaaI ACNGT 1 cut(s) 231
TasI AATT 3 cut(s) 153, 196, 291
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 5 cut(s) 152, 156, 173, 267, 359
Tru9I TTAA 5 cut(s) 152, 156, 173, 267, 359
TseI GCWGC 1 cut(s) 236
TspDTI ATGAA 3 cut(s) 113, 231, 326
XapI RAATTY 1 cut(s) 196
XspI CTAG 3 cut(s) 8, 210, 281
Zsp2I ATGCAT 2 cut(s) 64, 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.