RchiOBHm_Chr6g0259091

domain in FBox and BRCT domain containing plant proteins

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0001006
Physical Location & Seq
Forward (+)
14398297 .. 14398746
450 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23232

Sequence Viewer

Length: 222 bp
ATGCATAATTGTTCTCCAGGACAAGTGCCTATGTCTAAGGGTGATAAACTAAACAAGAGTCAATGCCCCAAAAATGATATTGAGAAAGAAGACATGAAGAGTAAACCATATTCTAGGCTTGTGGGGAGCTTGATGTATGCTCAAGTCTGTACTAGACCTGATTTGGCTTTTGCAGTAAGTATGTTAGCTAGGTTTCAATCCAATCCAGGACACGAACACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBD

Protein Analysis

73

Amino Acids

8.17

Weight (kDa)

8.91

Isoelectric Point (pI)

62.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 151
AgsI TTSAA 1 cut(s) 197
AjnI CCWGG 2 cut(s) 16, 205
AluBI AGCT 2 cut(s) 129, 188
AluI AGCT 2 cut(s) 129, 188
AsuHPI GGTGA 1 cut(s) 53
BbsI GAAGAC 1 cut(s) 96
BciT130I CCWGG 2 cut(s) 18, 207
BfaI CTAG 4 cut(s) 114, 153, 189, 220
Bme1390I CCNGG 2 cut(s) 18, 207
BmrFI CCNGG 2 cut(s) 18, 207
BpiI GAAGAC 1 cut(s) 96
BpuEI CTTGAG 1 cut(s) 126
BseBI CCWGG 2 cut(s) 18, 207
Bst2UI CCWGG 2 cut(s) 18, 207
Bst6I CTCTTC 1 cut(s) 92
BstDEI CTNAG 1 cut(s) 36
BstNI CCWGG 2 cut(s) 18, 207
BstSCI CCNGG 2 cut(s) 16, 205
BstV2I GAAGAC 1 cut(s) 96
Csp6I GTAC 1 cut(s) 150
CviAII CATG 1 cut(s) 94
CviJI RGCY 4 cut(s) 118, 129, 167, 188
CviKI_1 RGCY 4 cut(s) 118, 129, 167, 188
CviQI GTAC 1 cut(s) 150
DdeI CTNAG 1 cut(s) 36
Eam1104I CTCTTC 1 cut(s) 92
EarI CTCTTC 1 cut(s) 92
EcoRII CCWGG 2 cut(s) 16, 205
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 1 cut(s) 97
FaiI YATR 6 cut(s) 6, 32, 95, 109, 138, 182
FatI CATG 1 cut(s) 93
FspBI CTAG 4 cut(s) 114, 153, 189, 220
Hin1II CATG 1 cut(s) 97
HinfI GANTC 1 cut(s) 58
HphI GGTGA 1 cut(s) 53
Hpy166II GTNNAC 1 cut(s) 104
Hpy8I GTNNAC 1 cut(s) 104
HpyCH4V TGCA 2 cut(s) 4, 173
HpyF3I CTNAG 1 cut(s) 36
Hsp92II CATG 1 cut(s) 97
LmnI GCTCC 1 cut(s) 126
LpnPI CCDG 4 cut(s) 3, 30, 171, 192
MaeI CTAG 4 cut(s) 114, 153, 189, 220
MboII GAAGA 2 cut(s) 101, 109
MluCI AATT 1 cut(s) 7
MlyI GAGTC 1 cut(s) 67
Mph1103I ATGCAT 1 cut(s) 6
MspR9I CCNGG 2 cut(s) 18, 207
MvaI CCWGG 2 cut(s) 18, 207
NlaIII CATG 1 cut(s) 97
NsiI ATGCAT 1 cut(s) 6
PfoI TCCNGGA 2 cut(s) 16, 205
PleI GAGTC 1 cut(s) 66
PpsI GAGTC 1 cut(s) 66
Psp6I CCWGG 2 cut(s) 16, 205
PspGI CCWGG 2 cut(s) 16, 205
RsaI GTAC 1 cut(s) 151
RsaNI GTAC 1 cut(s) 150
SchI GAGTC 1 cut(s) 67
ScrFI CCNGG 2 cut(s) 18, 207
SetI ASST 4 cut(s) 131, 160, 190, 194
SmlI CTYRAG 1 cut(s) 141
SmoI CTYRAG 1 cut(s) 141
Sse9I AATT 1 cut(s) 7
SspMI CTAG 4 cut(s) 114, 153, 189, 220
StyD4I CCNGG 2 cut(s) 16, 205
TasI AATT 1 cut(s) 7
TatI WGTACW 1 cut(s) 149
TspDTI ATGAA 1 cut(s) 110
XspI CTAG 4 cut(s) 114, 153, 189, 220
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.