RchiOBHm_Chr7g0194431

transposition, RNA-mediated

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
12497158 .. 12497690
533 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ17386

Sequence Viewer

Length: 240 bp
ATGGTGATTTACTGTGATAATGCATCAGCAGTGTTCTTTTCAAAGAACAACAAGAGGTCTTCAAGTTCAAGGAACATTGATGTCAAGTACTTTGCAGTGAGAGAAAGTGTTAGGGATAAAGAGATCGAGGTTGTAAAGATTGGAACTAAAGATCAGTTAGCAGATCCATTGACAAAAGCTTTACCAGTAGCTGATTTTGTCAAGCATGCTGCACATATGGGAATTAAAGACATCATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

8.84

Weight (kDa)

9.17

Isoelectric Point (pI)

46.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 158
AfaI GTAC 1 cut(s) 89
AgsI TTSAA 3 cut(s) 42, 63, 69
AluBI AGCT 2 cut(s) 179, 191
AluI AGCT 2 cut(s) 179, 191
AlwI GGATC 1 cut(s) 158
AlwNI CAGNNNCTG 1 cut(s) 191
ApeKI GCWGC 1 cut(s) 209
AsuHPI GGTGA 1 cut(s) 16
BbsI GAAGAC 1 cut(s) 51
BbvI GCAGC 1 cut(s) 196
BfaI CTAG 1 cut(s) 238
BisI GCNGC 1 cut(s) 210
BlsI GCNGC 1 cut(s) 211
BmcAI AGTACT 1 cut(s) 89
BmsI GCATC 1 cut(s) 32
BpiI GAAGAC 1 cut(s) 51
Bse1I ACTGG 1 cut(s) 185
BseNI ACTGG 1 cut(s) 185
BseXI GCAGC 1 cut(s) 196
BsgI GTGCAG 1 cut(s) 195
Bsp143I GATC 3 cut(s) 123, 151, 163
BspPI GGATC 1 cut(s) 158
BsrI ACTGG 1 cut(s) 185
BssMI GATC 3 cut(s) 123, 151, 163
Bst4CI ACNGT 1 cut(s) 14
BstC8I GCNNGC 1 cut(s) 207
BstKTI GATC 3 cut(s) 126, 154, 166
BstMBI GATC 3 cut(s) 123, 151, 163
BstNSI RCATGY 1 cut(s) 209
BstV1I GCAGC 1 cut(s) 196
BstV2I GAAGAC 1 cut(s) 51
BstX2I RGATCY 1 cut(s) 163
BstYI RGATCY 1 cut(s) 163
BtsI GCAGTG 2 cut(s) 36, 102
BtsIMutI CAGTG 2 cut(s) 36, 102
Cac8I GCNNGC 1 cut(s) 207
CaiI CAGNNNCTG 1 cut(s) 191
Csp6I GTAC 1 cut(s) 88
CviAII CATG 1 cut(s) 206
CviJI RGCY 2 cut(s) 179, 191
CviKI_1 RGCY 2 cut(s) 179, 191
CviQI GTAC 1 cut(s) 88
DpnI GATC 3 cut(s) 125, 153, 165
DpnII GATC 3 cut(s) 123, 151, 163
EcoT22I ATGCAT 1 cut(s) 25
FaeI CATG 1 cut(s) 209
FaiI YATR 3 cut(s) 207, 216, 218
FatI CATG 1 cut(s) 205
FauNDI CATATG 1 cut(s) 216
Fnu4HI GCNGC 1 cut(s) 210
Fsp4HI GCNGC 1 cut(s) 210
FspBI CTAG 1 cut(s) 238
GluI GCNGC 1 cut(s) 210
Hin1II CATG 1 cut(s) 209
HindIII AAGCTT 1 cut(s) 177
HphI GGTGA 1 cut(s) 16
HpyCH4III ACNGT 1 cut(s) 14
HpyCH4V TGCA 3 cut(s) 23, 95, 212
Hsp92II CATG 1 cut(s) 209
Kzo9I GATC 3 cut(s) 123, 151, 163
LpnPI CCDG 1 cut(s) 198
Lsp1109I GCAGC 1 cut(s) 196
LweI GCATC 1 cut(s) 32
MaeI CTAG 1 cut(s) 238
MalI GATC 3 cut(s) 125, 153, 165
MboI GATC 3 cut(s) 123, 151, 163
MboII GAAGA 1 cut(s) 51
MflI RGATCY 1 cut(s) 163
MluCI AATT 1 cut(s) 222
MnlI CCTC 2 cut(s) 48, 121
Mph1103I ATGCAT 1 cut(s) 25
MseI TTAA 1 cut(s) 225
NdeI CATATG 1 cut(s) 216
NdeII GATC 3 cut(s) 123, 151, 163
NlaIII CATG 1 cut(s) 209
NsiI ATGCAT 1 cut(s) 25
NspI RCATGY 1 cut(s) 209
PaeI GCATGC 1 cut(s) 209
PkrI GCNGC 1 cut(s) 211
PstNI CAGNNNCTG 1 cut(s) 191
PsuI RGATCY 1 cut(s) 163
RsaI GTAC 1 cut(s) 89
RsaNI GTAC 1 cut(s) 88
SaqAI TTAA 1 cut(s) 225
SatI GCNGC 1 cut(s) 210
Sau3AI GATC 3 cut(s) 123, 151, 163
ScaI AGTACT 1 cut(s) 89
SetI ASST 4 cut(s) 59, 132, 181, 193
SfaNI GCATC 1 cut(s) 32
SgeI CNNG 8 cut(s) 64, 75, 81, 97, 139, 197, 214, 218
SphI GCATGC 1 cut(s) 209
Sse9I AATT 1 cut(s) 222
SspMI CTAG 1 cut(s) 238
TaaI ACNGT 1 cut(s) 14
TaqI TCGA 1 cut(s) 126
TasI AATT 1 cut(s) 222
TatI WGTACW 1 cut(s) 87
Tru1I TTAA 1 cut(s) 225
Tru9I TTAA 1 cut(s) 225
TscAI CASTG 2 cut(s) 36, 102
TseI GCWGC 1 cut(s) 209
TspRI CASTG 2 cut(s) 36, 102
XceI RCATGY 1 cut(s) 209
XspI CTAG 1 cut(s) 238
ZrmI AGTACT 1 cut(s) 89
Zsp2I ATGCAT 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.