Rroxscaffold_2G00112920

beta-1,3-galactosyltransferase 3

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
38363969 .. 38368529
4561 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00112920.1

Sequence Viewer

Length: 153 bp
ATGAAGCAGTCATTAATAGCTACTTCCACCATGCAAGCAGAGGTGATATCTATATATGAAGGAGTTTGTGAAGGTTTATGGATTAGAAATTATATTTTGGAAACCAAAGTCTTGAGTGATTTAGTTACTTGGAAGTTTGAAAGTGTTTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.74

Weight (kDa)

4.71

Isoelectric Point (pI)

28.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 140
AluBI AGCT 1 cut(s) 20
AluI AGCT 1 cut(s) 20
AseI ATTAAT 1 cut(s) 14
AsuHPI GGTGA 1 cut(s) 55
BpuEI CTTGAG 1 cut(s) 133
BstC8I GCNNGC 1 cut(s) 36
Cac8I GCNNGC 1 cut(s) 36
CviAII CATG 1 cut(s) 31
CviJI RGCY 1 cut(s) 20
CviKI_1 RGCY 1 cut(s) 20
Eco32I GATATC 1 cut(s) 48
EcoRV GATATC 1 cut(s) 48
FaeI CATG 1 cut(s) 34
FaiI YATR 6 cut(s) 32, 53, 55, 57, 79, 93
FatI CATG 1 cut(s) 30
FspEI CC 9 cut(s) 26, 40, 43, 45, 57, 64, 83, 115, 118
Hin1II CATG 1 cut(s) 34
HphI GGTGA 1 cut(s) 55
Hpy188III TCNNGA 1 cut(s) 112
HpyAV CCTTC 2 cut(s) 53, 65
HpyCH4V TGCA 1 cut(s) 34
Hsp92II CATG 1 cut(s) 34
MaeIII GTNAC 1 cut(s) 124
MluCI AATT 1 cut(s) 88
MnlI CCTC 1 cut(s) 34
MseI TTAA 1 cut(s) 14
NlaIII CATG 1 cut(s) 34
PshBI ATTAAT 1 cut(s) 14
SaqAI TTAA 1 cut(s) 14
SetI ASST 3 cut(s) 22, 45, 76
SgeI CNNG 4 cut(s) 43, 47, 124, 141
SmlI CTYRAG 1 cut(s) 112
SmoI CTYRAG 1 cut(s) 112
Sse9I AATT 1 cut(s) 88
TasI AATT 1 cut(s) 88
Tru1I TTAA 1 cut(s) 14
Tru9I TTAA 1 cut(s) 14
TspDTI ATGAA 2 cut(s) 17, 72
VspI ATTAAT 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.