RchiOBHm_Chr2g0150761

Reverse transcriptase (RNA-dependent DNA polymerase)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0001006
Physical Location & Seq
Forward (+)
68433516 .. 68433892
377 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ52001

Sequence Viewer

Length: 318 bp
ATGAAAACCAGTGGCAGGAATTTTATTTTTTTTGTGCTTTATGTGGATGATATTTTATTGGCATGCACTGATAAAGGGCTGCTGCAGGAGACCAAGTCTTTTCTTTCAAGTAATTTTGATATGAAAGACTTGGGAGAGACTTCCTATGTTCTGGGAATAGAAATCACTAGAGATAGAACCAAGCACTTGCTAGGACTATCCCAGCAAAATTACATTTCAAAGATATTGAAGAGATTTGAAATGCATAATTGTTCTCCAGGACAAGTGCCTATGTCTAAGGGTGATAAACTGAACAAGAGTCAATGCCCCAAAAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_2

Protein Analysis

105

Amino Acids

11.98

Weight (kDa)

9.22

Isoelectric Point (pI)

51.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_2 PF07727 2 - 92 1.5e-19 Reverse transcriptase (RNA-dependent DNA polymerase)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 19
AfiI CCNNNNNNNGG 1 cut(s) 15
AgsI TTSAA 4 cut(s) 108, 219, 229, 239
AjnI CCWGG 1 cut(s) 256
Alw26I GTCTC 2 cut(s) 83, 131
ApeKI GCWGC 2 cut(s) 79, 82
ApoI RAATTY 1 cut(s) 19
AsuHPI GGTGA 1 cut(s) 293
BbvI GCAGC 2 cut(s) 66, 69
BciT130I CCWGG 1 cut(s) 258
BcoDI GTCTC 2 cut(s) 83, 131
BfaI CTAG 2 cut(s) 168, 191
BfmI CTRYAG 1 cut(s) 83
BisI GCNGC 2 cut(s) 80, 83
BlsI GCNGC 2 cut(s) 81, 84
Bme1390I CCNGG 1 cut(s) 258
BmrFI CCNGG 1 cut(s) 258
BpmI CTGGAG 1 cut(s) 240
BsaI GGTCTC 1 cut(s) 83
BsaXI ACNNNNNCTCC 2 cut(s) 80, 110
Bsc4I CCNNNNNNNGG 1 cut(s) 15
Bse1I ACTGG 1 cut(s) 9
BseBI CCWGG 1 cut(s) 258
BseGI GGATG 1 cut(s) 52
BseLI CCNNNNNNNGG 1 cut(s) 15
BseNI ACTGG 1 cut(s) 9
BseXI GCAGC 2 cut(s) 66, 69
BseYI CCCAGC 1 cut(s) 201
BslI CCNNNNNNNGG 1 cut(s) 15
BsmAI GTCTC 2 cut(s) 83, 131
Bso31I GGTCTC 1 cut(s) 83
BspMAI CTGCAG 1 cut(s) 87
BspTNI GGTCTC 1 cut(s) 83
BsrI ACTGG 1 cut(s) 9
Bst2UI CCWGG 1 cut(s) 258
Bst6I CTCTTC 1 cut(s) 224
BstC8I GCNNGC 1 cut(s) 64
BstDEI CTNAG 1 cut(s) 276
BstF5I GGATG 1 cut(s) 52
BstMAI GTCTC 2 cut(s) 83, 131
BstNI CCWGG 1 cut(s) 258
BstNSI RCATGY 1 cut(s) 66
BstSCI CCNGG 1 cut(s) 256
BstSFI CTRYAG 1 cut(s) 83
BstV1I GCAGC 2 cut(s) 66, 69
BtsCI GGATG 1 cut(s) 52
BtsIMutI CAGTG 2 cut(s) 16, 66
Cac8I GCNNGC 1 cut(s) 64
CviAII CATG 1 cut(s) 63
CviJI RGCY 1 cut(s) 79
CviKI_1 RGCY 1 cut(s) 79
DdeI CTNAG 1 cut(s) 276
Eam1104I CTCTTC 1 cut(s) 224
EarI CTCTTC 1 cut(s) 224
Eco31I GGTCTC 1 cut(s) 83
EcoRII CCWGG 1 cut(s) 256
EcoT22I ATGCAT 1 cut(s) 246
FaeI CATG 1 cut(s) 66
FaiI YATR 6 cut(s) 42, 64, 122, 147, 246, 272
FatI CATG 1 cut(s) 62
Fnu4HI GCNGC 2 cut(s) 80, 83
FokI GGATG 1 cut(s) 59
Fsp4HI GCNGC 2 cut(s) 80, 83
FspBI CTAG 2 cut(s) 168, 191
GluI GCNGC 2 cut(s) 80, 83
GsaI CCCAGC 1 cut(s) 205
GsuI CTGGAG 1 cut(s) 240
Hin1II CATG 1 cut(s) 66
HinfI GANTC 1 cut(s) 298
HphI GGTGA 1 cut(s) 293
HpyCH4V TGCA 3 cut(s) 66, 85, 244
HpyF3I CTNAG 1 cut(s) 276
Hsp92II CATG 1 cut(s) 66
LpnPI CCDG 6 cut(s) 22, 71, 137, 215, 243, 270
Lsp1109I GCAGC 2 cut(s) 66, 69
MaeI CTAG 2 cut(s) 168, 191
MboII GAAGA 1 cut(s) 241
MluCI AATT 4 cut(s) 19, 112, 208, 247
MlyI GAGTC 1 cut(s) 307
Mph1103I ATGCAT 1 cut(s) 246
MspR9I CCNGG 1 cut(s) 258
MvaI CCWGG 1 cut(s) 258
NlaIII CATG 1 cut(s) 66
NsiI ATGCAT 1 cut(s) 246
NspI RCATGY 1 cut(s) 66
PaeI GCATGC 1 cut(s) 66
PflFI GACNNNGTC 1 cut(s) 94
PfoI TCCNGGA 1 cut(s) 256
PkrI GCNGC 2 cut(s) 81, 84
PleI GAGTC 1 cut(s) 306
PpsI GAGTC 1 cut(s) 306
Psp6I CCWGG 1 cut(s) 256
PspFI CCCAGC 1 cut(s) 201
PspGI CCWGG 1 cut(s) 256
PstI CTGCAG 1 cut(s) 87
PsyI GACNNNGTC 1 cut(s) 94
SatI GCNGC 2 cut(s) 80, 83
SchI GAGTC 1 cut(s) 307
ScrFI CCNGG 1 cut(s) 258
SfcI CTRYAG 1 cut(s) 83
SphI GCATGC 1 cut(s) 66
Sse9I AATT 4 cut(s) 19, 112, 208, 247
SspMI CTAG 2 cut(s) 168, 191
StyD4I CCNGG 1 cut(s) 256
TasI AATT 4 cut(s) 19, 112, 208, 247
TscAI CASTG 2 cut(s) 16, 73
TseI GCWGC 2 cut(s) 79, 82
TspDTI ATGAA 2 cut(s) 17, 137
TspRI CASTG 2 cut(s) 16, 73
Tth111I GACNNNGTC 1 cut(s) 94
XapI RAATTY 1 cut(s) 19
XceI RCATGY 1 cut(s) 66
XspI CTAG 2 cut(s) 168, 191
Zsp2I ATGCAT 1 cut(s) 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.