Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr3

Orthogroup ID

OG0001006

Physical Location & Seq

Genomic Coordinates Forward (+)

17749145 .. 17750297

Gene Structure 1153 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom03g16600.2

Sequence Viewer

CDS Protein Promoter (2k)

Length: 858 bp

ATGGCACTAGTTGCACACTTTGATCTAAAGTTACATCAAATGGATGTGAAGACTGTTTTTCTCCATGGTAAACTACAAGAAAACATTTACATGCAACAGCCTCCTGGATTTGTTGAAAGGGGGAAAGAAAACATGGTATGCAAGCTCAACAAGTCCATTTATGGAGTGAAGCAAGCATCAAGACAGTGGTTTTTAAAATTTGATCAAGTTGTTACAAAGCATGGTTTTGTGGAAAACGAATTGGATGATTACATATACATTAAGTGGTCAGGTTCAAGCTTTATTATTTTGGTATTGTATGTCGATGATATCTTACTAGCAAGTTCTAATGTGAAGCTCCTCAATGATACTAAGGCCATACTTAGCAAGAACTTTGAGATGAAGGACCTTGGAGAGGCACACTATGTGCTTGGCATTGAAACCATTCAAGACAGGTCCAAAAGGCTAATTAGACTATCACAAAGGGGTTATTTAGAAAGAGTACTCCTGAGATTTAATATGGAAAAGTGTAATAATGGTGAAATACCTATGAATAAGGGAGACAAATTCTCTAAAGCTCACTGTCCCAAGACATCCATAGAGGGTGGTACAGTTTCATGGAAAAGTGCTAAACAAACTATAATTGCCACTTCTACCATGGAGGCAAAGTTTATAGCTTGTTTTGAAGGGATGAAACAAGTTGTATGGTTAAGAAATTTCCTAAGTGATTTAAGAATTGTTGATTCGGTGCAAGGGCATGTTAAGATGTATTGTGATAATAACTCTGTAGTATTTTTTGCTAAGAATAATAGAAGAACTTCAGCTTCTAGATTGATGGATGTGAAGTTTCTTAAGGTTCGAGAAAAGGTTCAGGATTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_2

Protein Analysis

286

Amino Acids

32.89

Weight (kDa)

9.4

Isoelectric Point (pI)

34.48

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001006)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g28582 FvH4_4g04791 FvH4_5g37183 FvH4_6g21376 FvH4_7g12362
malus_domestica	MD04G1043200.v1.1 MD08G1171400.v1.1 MD16G1163300.v1.1
pyrus_communis	pycom01g08240 pycom02g13280 pycom02g13290 pycom03g16600 pycom04g18500 pycom06g06360 pycom12g01620 pycom15g38160
rosa_chinensis	RchiOBHm_Chr1g0317711 RchiOBHm_Chr1g0337471 RchiOBHm_Chr1g0365501 RchiOBHm_Chr1g0375591 RchiOBHm_Chr1g0383411 RchiOBHm_Chr2g0115341 RchiOBHm_Chr2g0144381 RchiOBHm_Chr2g0150761 RchiOBHm_Chr2g0159601 RchiOBHm_Chr3g0453781 RchiOBHm_Chr3g0467131 RchiOBHm_Chr3g0491311 RchiOBHm_Chr3g0495711 RchiOBHm_Chr4g0385651 RchiOBHm_Chr4g0390931 RchiOBHm_Chr4g0441701 RchiOBHm_Chr5g0040291 RchiOBHm_Chr5g0040891 RchiOBHm_Chr5g0066231 RchiOBHm_Chr5g0076641 RchiOBHm_Chr6g0259091 RchiOBHm_Chr6g0300011 RchiOBHm_Chr6g0304531 RchiOBHm_Chr7g0192701 RchiOBHm_Chr7g0194431
rosa_roxburghii	Rroxscaffold_2G00112920 Rroxscaffold_3G00225970 Rroxscaffold_3G00227430 Rroxscaffold_4G00301360 Rroxscaffold_4G00305440 Rroxscaffold_5G00386330
rosa_wichuraiana	Rw0G010510 Rw1G007900 Rw1G018220 Rw1G022080 Rw2G040570 Rw2G046740 Rw4G002540 Rw5G013410 Rw5G017210 Rw5G017940 Rw7G005960 Rw7G007520 Rw7G012200 Rw7G030860 Rw7G032010

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	3 cut(s)	197, 545, 694
AcuI	CTGAAG	1 cut(s)	783
AdeI	CACNNNGTG	1 cut(s)	406
AfaI	GTAC	2 cut(s)	483, 589
AfiI	CCNNNNNNNGG	1 cut(s)	394
AflII	CTTAAG	1 cut(s)	830
AgsI	TTSAA	5 cut(s)	116, 276, 419, 428, 665
AhlI	ACTAGT	1 cut(s)	7
AjnI	CCWGG	1 cut(s)	103
AluBI	AGCT	6 cut(s)	145, 279, 337, 557, 656, 803
AluI	AGCT	6 cut(s)	145, 279, 337, 557, 656, 803
Alw26I	GTCTC	1 cut(s)	534
AoxI	GGCC	1 cut(s)	354
ApoI	RAATTY	3 cut(s)	197, 545, 694
Asp700I	GAANNNNTTC	3 cut(s)	423, 796, 846
AspS9I	GGNCC	2 cut(s)	385, 435
AsuHPI	GGTGA	1 cut(s)	530
AvaII	GGWCC	2 cut(s)	385, 435
BbsI	GAAGAC	1 cut(s)	56
BccI	CCATC	1 cut(s)	808
BciT130I	CCWGG	1 cut(s)	105
BclI	TGATCA	1 cut(s)	202
BcoDI	GTCTC	1 cut(s)	534
BcuI	ACTAGT	1 cut(s)	7
BfaI	CTAG	3 cut(s)	8, 317, 807
BfmI	CTRYAG	1 cut(s)	765
BfrI	CTTAAG	1 cut(s)	830
BmcAI	AGTACT	1 cut(s)	483
Bme1390I	CCNGG	1 cut(s)	105
Bme18I	GGWCC	2 cut(s)	385, 435
BmgT120I	GGNCC	2 cut(s)	385, 435
BmrFI	CCNGG	1 cut(s)	105
BmsI	GCATC	1 cut(s)	185
BpiI	GAAGAC	1 cut(s)	56
BsaJI	CCNNGG	3 cut(s)	64, 388, 636
BsaXI	ACNNNNNCTCC	2 cut(s)	632, 662
Bsc4I	CCNNNNNNNGG	1 cut(s)	394
BseBI	CCWGG	1 cut(s)	105
BseDI	CCNNGG	3 cut(s)	64, 388, 636
BseGI	GGATG	5 cut(s)	49, 250, 572, 675, 823
BseLI	CCNNNNNNNGG	1 cut(s)	394
BseMII	CTCAG	1 cut(s)	479
BseRI	GAGGAG	1 cut(s)	329
BshFI	GGCC	1 cut(s)	356
BslFI	GGGAC	1 cut(s)	549
BslI	CCNNNNNNNGG	1 cut(s)	394
BsmAI	GTCTC	1 cut(s)	534
BsmFI	GGGAC	1 cut(s)	549
BsnI	GGCC	1 cut(s)	356
Bsp143I	GATC	2 cut(s)	22, 202
Bsp19I	CCATGG	2 cut(s)	64, 636
BspANI	GGCC	1 cut(s)	356
BspCNI	CTCAG	1 cut(s)	480
BspTI	CTTAAG	1 cut(s)	830
BssECI	CCNNGG	3 cut(s)	64, 388, 636
BssMI	GATC	2 cut(s)	22, 202
BssT1I	CCWWGG	3 cut(s)	64, 388, 636
Bst2UI	CCWGG	1 cut(s)	105
Bst4CI	ACNGT	4 cut(s)	55, 186, 563, 592
BstAFI	CTTAAG	1 cut(s)	830
BstAPI	GCANNNNNTGC	1 cut(s)	11
BstC8I	GCNNGC	2 cut(s)	143, 174
BstDEI	CTNAG	5 cut(s)	351, 362, 488, 701, 780
BstDSI	CCRYGG	2 cut(s)	64, 636
BstENI	CCTNNNNNAGG	1 cut(s)	392
BstF5I	GGATG	5 cut(s)	49, 250, 572, 675, 823
BstKTI	GATC	2 cut(s)	25, 205
BstMAI	GTCTC	1 cut(s)	534
BstMBI	GATC	2 cut(s)	22, 202
BstMWI	GCNNNNNNNGC	1 cut(s)	11
BstNI	CCWGG	1 cut(s)	105
BstNSI	RCATGY	2 cut(s)	94, 740
BstSCI	CCNGG	1 cut(s)	103
BstSFI	CTRYAG	1 cut(s)	765
BstV2I	GAAGAC	1 cut(s)	56
BsuRI	GGCC	1 cut(s)	356
BtgI	CCRYGG	2 cut(s)	64, 636
BtsCI	GGATG	5 cut(s)	49, 250, 572, 675, 823
BtsIMutI	CAGTG	2 cut(s)	191, 559
Cac8I	GCNNGC	2 cut(s)	143, 174
Cfr13I	GGNCC	2 cut(s)	385, 435
Csp6I	GTAC	2 cut(s)	482, 588
CviAII	CATG	7 cut(s)	65, 91, 133, 221, 597, 637, 737
CviJI	RGCY	9 cut(s)	100, 145, 279, 337, 356, 445, 557, 656, 803
CviKI_1	RGCY	9 cut(s)	100, 145, 279, 337, 356, 445, 557, 656, 803
CviQI	GTAC	2 cut(s)	482, 588
DdeI	CTNAG	5 cut(s)	351, 362, 488, 701, 780
DpnI	GATC	2 cut(s)	24, 204
DpnII	GATC	2 cut(s)	22, 202
DraI	TTTAAA	1 cut(s)	195
DraIII	CACNNNGTG	1 cut(s)	406
Eco130I	CCWWGG	3 cut(s)	64, 388, 636
Eco32I	GATATC	1 cut(s)	310
Eco47I	GGWCC	2 cut(s)	385, 435
Eco57I	CTGAAG	1 cut(s)	783
EcoNI	CCTNNNNNAGG	1 cut(s)	392
EcoO109I	RGGNCCY	1 cut(s)	385
EcoRII	CCWGG	1 cut(s)	103
EcoRV	GATATC	1 cut(s)	310
EcoT14I	CCWWGG	3 cut(s)	64, 388, 636
ErhI	CCWWGG	3 cut(s)	64, 388, 636
FaeI	CATG	7 cut(s)	68, 94, 136, 224, 600, 640, 740
FaqI	GGGAC	1 cut(s)	549
FatI	CATG	7 cut(s)	64, 90, 132, 220, 596, 636, 736
FbaI	TGATCA	1 cut(s)	202
FokI	GGATG	5 cut(s)	56, 257, 559, 682, 830
FspBI	CTAG	3 cut(s)	8, 317, 807
HaeIII	GGCC	1 cut(s)	356
Hin1II	CATG	7 cut(s)	68, 94, 136, 224, 600, 640, 740
HindIII	AAGCTT	1 cut(s)	277
HinfI	GANTC	1 cut(s)	722
HphI	GGTGA	1 cut(s)	530
Hpy166II	GTNNAC	1 cut(s)	71
Hpy188III	TCNNGA	6 cut(s)	180, 428, 487, 807, 839, 851
Hpy8I	GTNNAC	1 cut(s)	71
HpyAV	CCTTC	2 cut(s)	376, 659
HpyCH4III	ACNGT	4 cut(s)	55, 186, 563, 592
HpyCH4V	TGCA	4 cut(s)	14, 94, 141, 730
HpyF10VI	GCNNNNNNNGC	1 cut(s)	11
HpyF3I	CTNAG	5 cut(s)	351, 362, 488, 701, 780
Hsp92II	CATG	7 cut(s)	68, 94, 136, 224, 600, 640, 740
Ksp22I	TGATCA	1 cut(s)	202
Kzo9I	GATC	2 cut(s)	22, 202
LmnI	GCTCC	1 cut(s)	342
LpnPI	CCDG	6 cut(s)	90, 117, 255, 418, 500, 836
LweI	GCATC	1 cut(s)	185
MaeI	CTAG	3 cut(s)	8, 317, 807
MaeIII	GTNAC	2 cut(s)	30, 211
MalI	GATC	2 cut(s)	24, 204
MboI	GATC	2 cut(s)	22, 202
MboII	GAAGA	2 cut(s)	61, 804
MluCI	AATT	7 cut(s)	197, 239, 447, 545, 621, 694, 714
MnlI	CCTC	5 cut(s)	111, 350, 388, 574, 634
MroXI	GAANNNNTTC	3 cut(s)	423, 796, 846
MseI	TTAA	7 cut(s)	194, 261, 495, 689, 710, 741, 831
MslI	CAYNNNNRTG	1 cut(s)	89
MspCI	CTTAAG	1 cut(s)	830
MspR9I	CCNGG	1 cut(s)	105
MvaI	CCWGG	1 cut(s)	105
MwoI	GCNNNNNNNGC	1 cut(s)	11
NcoI	CCATGG	2 cut(s)	64, 636
NdeII	GATC	2 cut(s)	22, 202
NlaIII	CATG	7 cut(s)	68, 94, 136, 224, 600, 640, 740
NspI	RCATGY	2 cut(s)	94, 740
PdmI	GAANNNNTTC	3 cut(s)	423, 796, 846
PfeI	GAWTC	1 cut(s)	722
PfoI	TCCNGGA	1 cut(s)	103
PpuMI	RGGWCCY	1 cut(s)	385
Psp5II	RGGWCCY	1 cut(s)	385
Psp6I	CCWGG	1 cut(s)	103
PspGI	CCWGG	1 cut(s)	103
PspPI	GGNCC	2 cut(s)	385, 435
PspPPI	RGGWCCY	1 cut(s)	385
RsaI	GTAC	2 cut(s)	483, 589
RsaNI	GTAC	2 cut(s)	482, 588
RseI	CAYNNNNRTG	1 cut(s)	89
SaqAI	TTAA	7 cut(s)	194, 261, 495, 689, 710, 741, 831
Sau3AI	GATC	2 cut(s)	22, 202
Sau96I	GGNCC	2 cut(s)	385, 435
ScaI	AGTACT	1 cut(s)	483
ScrFI	CCNGG	1 cut(s)	105
SfaNI	GCATC	1 cut(s)	185
SfcI	CTRYAG	1 cut(s)	765
SinI	GGWCC	2 cut(s)	385, 435
SmiMI	CAYNNNNRTG	1 cut(s)	89
SmlI	CTYRAG	1 cut(s)	830
SmoI	CTYRAG	1 cut(s)	830
SpeI	ACTAGT	1 cut(s)	7
Sse9I	AATT	7 cut(s)	197, 239, 447, 545, 621, 694, 714
SspMI	CTAG	3 cut(s)	8, 317, 807
StyD4I	CCNGG	1 cut(s)	103
StyI	CCWWGG	3 cut(s)	64, 388, 636
TaaI	ACNGT	4 cut(s)	55, 186, 563, 592
TaqI	TCGA	2 cut(s)	303, 838
TasI	AATT	7 cut(s)	197, 239, 447, 545, 621, 694, 714
TatI	WGTACW	1 cut(s)	481
TfiI	GAWTC	1 cut(s)	722
Tru1I	TTAA	7 cut(s)	194, 261, 495, 689, 710, 741, 831
Tru9I	TTAA	7 cut(s)	194, 261, 495, 689, 710, 741, 831
TscAI	CASTG	2 cut(s)	191, 566
TspDTI	ATGAA	4 cut(s)	395, 545, 585, 686
TspRI	CASTG	2 cut(s)	191, 566
Vha464I	CTTAAG	1 cut(s)	830
VpaK11BI	GGWCC	2 cut(s)	385, 435
XagI	CCTNNNNNAGG	1 cut(s)	392
XapI	RAATTY	3 cut(s)	197, 545, 694
XbaI	TCTAGA	1 cut(s)	806
XceI	RCATGY	2 cut(s)	94, 740
XcmI	CCANNNNNNNNNTGG	1 cut(s)	634
XmnI	GAANNNNTTC	3 cut(s)	423, 796, 846
XspI	CTAG	3 cut(s)	8, 317, 807
ZrmI	AGTACT	1 cut(s)	483

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.