RchiOBHm_Chr3g0471881

catalytic domain of ctd-like phosphatases

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
17776888 .. 17777793
906 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 531 bp
ATGGGGATGATGATGCATGGTGACTATGATAGTGTTTCCTGTCGCAGTGATGGCAATGACTGCGATAACGAAGACACTGGAAGCCATTGTGGCCTTTCACTACAGAAGCTGAATTTAGGACCAAGAAAGAAGCTTCTTGTTTTCAATCTCCATGGGTGTTTAATCAACAGGGTTTACCGGCACGACAGTCAGGCCAGAATTCCAAGTGATCGTAGTCCTGATGGCAGATATGGAAATCATCTAGTTTTTAAAAGACCTTTTGCAGAGGGGTTCATGCAATTCTGTTTTGAAAGATTTGAAATTGGCAATATAGTCTTCTGCCCAAGAGAAAATGTTGATGATATCTCGGAGTGTATGATGGGAAGACTGAGAAACAGGCTGTCATTTGATCAAGTTGAATGCACTGAAACCGGGTTCAAGTTGGTAGAGAATAGATCGAAGCCCTTGTTTCTTAAAGAACTGAAGGAATTGTGGAAATATCTTGATTGGCAGTATTCTGAATCCGACACACTGTTGATTGATGGTAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

176

Amino Acids

20.46

Weight (kDa)

5.96

Isoelectric Point (pI)

44.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 112, 198
AcuI CTGAAG 1 cut(s) 482
AgsI TTSAA 5 cut(s) 145, 290, 299, 398, 418
AluBI AGCT 2 cut(s) 109, 133
AluI AGCT 2 cut(s) 109, 133
AlwNI CAGNNNCTG 1 cut(s) 109
AoxI GGCC 2 cut(s) 91, 192
ApoI RAATTY 2 cut(s) 112, 198
AspS9I GGNCC 1 cut(s) 119
AsuC2I CCSGG 1 cut(s) 412
AsuHPI GGTGA 1 cut(s) 32
AvaII GGWCC 1 cut(s) 119
BbsI GAAGAC 3 cut(s) 78, 307, 370
BccI CCATC 4 cut(s) 44, 215, 352, 515
BclI TGATCA 1 cut(s) 388
BcnI CCSGG 1 cut(s) 412
BfaI CTAG 1 cut(s) 242
BfmI CTRYAG 1 cut(s) 101
BglI GCCNNNNNGGC 1 cut(s) 90
Bme1390I CCNGG 1 cut(s) 412
Bme18I GGWCC 1 cut(s) 119
BmgT120I GGNCC 1 cut(s) 119
BmrFI CCNGG 1 cut(s) 412
BmsI GCATC 1 cut(s) 3
BpiI GAAGAC 3 cut(s) 78, 307, 370
BpuMI CCSGG 1 cut(s) 412
BsaJI CCNNGG 1 cut(s) 151
Bse118I RCCGGY 1 cut(s) 177
Bse1I ACTGG 1 cut(s) 82
Bse3DI GCAATG 1 cut(s) 61
BseDI CCNNGG 1 cut(s) 151
BseGI GGATG 1 cut(s) 12
BseMI GCAATG 1 cut(s) 61
BseMII CTCAG 1 cut(s) 359
BseNI ACTGG 1 cut(s) 82
BshFI GGCC 2 cut(s) 93, 194
BsiSI CCGG 2 cut(s) 178, 411
BsmI GAATGC 1 cut(s) 404
BsnI GGCC 2 cut(s) 93, 194
Bsp143I GATC 3 cut(s) 208, 388, 434
Bsp19I CCATGG 1 cut(s) 151
BspANI GGCC 2 cut(s) 93, 194
BspCNI CTCAG 1 cut(s) 360
BsrDI GCAATG 1 cut(s) 61
BsrFI RCCGGY 1 cut(s) 177
BsrI ACTGG 1 cut(s) 82
BssAI RCCGGY 1 cut(s) 177
BssECI CCNNGG 1 cut(s) 151
BssMI GATC 3 cut(s) 208, 388, 434
BssT1I CCWWGG 1 cut(s) 151
Bst4CI ACNGT 2 cut(s) 188, 513
BstAPI GCANNNNNTGC 1 cut(s) 60
BstDEI CTNAG 1 cut(s) 368
BstDSI CCRYGG 1 cut(s) 151
BstF5I GGATG 1 cut(s) 12
BstKTI GATC 3 cut(s) 211, 391, 437
BstMBI GATC 3 cut(s) 208, 388, 434
BstMWI GCNNNNNNNGC 3 cut(s) 51, 60, 90
BstSCI CCNGG 1 cut(s) 410
BstSFI CTRYAG 1 cut(s) 101
BstV2I GAAGAC 3 cut(s) 78, 307, 370
BsuRI GGCC 2 cut(s) 93, 194
BtgI CCRYGG 1 cut(s) 151
BtsCI GGATG 1 cut(s) 12
BtsI GCAGTG 1 cut(s) 52
BtsIMutI CAGTG 4 cut(s) 52, 75, 402, 509
CaiI CAGNNNCTG 1 cut(s) 109
Cfr10I RCCGGY 1 cut(s) 177
Cfr13I GGNCC 1 cut(s) 119
CviAII CATG 3 cut(s) 17, 152, 274
CviJI RGCY 7 cut(s) 84, 93, 109, 133, 194, 379, 442
CviKI_1 RGCY 7 cut(s) 84, 93, 109, 133, 194, 379, 442
DdeI CTNAG 1 cut(s) 368
DpnI GATC 3 cut(s) 210, 390, 436
DpnII GATC 3 cut(s) 208, 388, 434
DraI TTTAAA 1 cut(s) 250
Eco130I CCWWGG 1 cut(s) 151
Eco32I GATATC 1 cut(s) 343
Eco47I GGWCC 1 cut(s) 119
Eco57I CTGAAG 1 cut(s) 482
EcoRI GAATTC 1 cut(s) 198
EcoRV GATATC 1 cut(s) 343
EcoT14I CCWWGG 1 cut(s) 151
EcoT22I ATGCAT 1 cut(s) 18
ErhI CCWWGG 1 cut(s) 151
FaeI CATG 3 cut(s) 20, 155, 277
FaiI YATR 7 cut(s) 18, 27, 153, 231, 275, 311, 356
FatI CATG 3 cut(s) 16, 151, 273
FbaI TGATCA 1 cut(s) 388
FokI GGATG 1 cut(s) 19
FspBI CTAG 1 cut(s) 242
HaeIII GGCC 2 cut(s) 93, 194
HapII CCGG 2 cut(s) 178, 411
Hin1II CATG 3 cut(s) 20, 155, 277
HindIII AAGCTT 1 cut(s) 131
HinfI GANTC 1 cut(s) 500
HpaII CCGG 2 cut(s) 178, 411
HphI GGTGA 1 cut(s) 32
Hpy166II GTNNAC 1 cut(s) 175
Hpy188I TCNGA 3 cut(s) 349, 499, 505
Hpy188III TCNNGA 2 cut(s) 218, 482
Hpy8I GTNNAC 1 cut(s) 175
HpyAV CCTTC 1 cut(s) 457
HpyCH4III ACNGT 2 cut(s) 188, 513
HpyCH4V TGCA 4 cut(s) 16, 263, 277, 402
HpyF10VI GCNNNNNNNGC 3 cut(s) 51, 60, 90
HpyF3I CTNAG 1 cut(s) 368
Hsp92II CATG 3 cut(s) 20, 155, 277
Ksp22I TGATCA 1 cut(s) 388
Kzo9I GATC 3 cut(s) 208, 388, 434
LpnPI CCDG 9 cut(s) 52, 63, 154, 176, 191, 208, 231, 361, 424
LweI GCATC 1 cut(s) 3
MaeI CTAG 1 cut(s) 242
MaeIII GTNAC 1 cut(s) 20
MalI GATC 3 cut(s) 210, 390, 436
MboI GATC 3 cut(s) 208, 388, 434
MboII GAAGA 3 cut(s) 83, 307, 375
MluCI AATT 5 cut(s) 112, 198, 278, 300, 467
MmeI TCCRAC 1 cut(s) 528
MnlI CCTC 1 cut(s) 259
Mph1103I ATGCAT 1 cut(s) 18
MseI TTAA 3 cut(s) 161, 249, 453
MspI CCGG 2 cut(s) 178, 411
MspR9I CCNGG 1 cut(s) 412
Mva1269I GAATGC 1 cut(s) 404
MwoI GCNNNNNNNGC 3 cut(s) 51, 60, 90
NciI CCSGG 1 cut(s) 412
NcoI CCATGG 1 cut(s) 151
NdeII GATC 3 cut(s) 208, 388, 434
NlaIII CATG 3 cut(s) 20, 155, 277
NmuCI GTSAC 1 cut(s) 20
NsiI ATGCAT 1 cut(s) 18
PctI GAATGC 1 cut(s) 404
PfeI GAWTC 1 cut(s) 500
PspPI GGNCC 1 cut(s) 119
PstNI CAGNNNCTG 1 cut(s) 109
SaqAI TTAA 3 cut(s) 161, 249, 453
Sau3AI GATC 3 cut(s) 208, 388, 434
Sau96I GGNCC 1 cut(s) 119
ScrFI CCNGG 1 cut(s) 412
SetI ASST 3 cut(s) 111, 135, 259
SfaNI GCATC 1 cut(s) 3
SfcI CTRYAG 1 cut(s) 101
SinI GGWCC 1 cut(s) 119
Sse9I AATT 5 cut(s) 112, 198, 278, 300, 467
SspMI CTAG 1 cut(s) 242
StyD4I CCNGG 1 cut(s) 410
StyI CCWWGG 1 cut(s) 151
TaaI ACNGT 2 cut(s) 188, 513
TaqI TCGA 1 cut(s) 437
TasI AATT 5 cut(s) 112, 198, 278, 300, 467
TfiI GAWTC 1 cut(s) 500
Tru1I TTAA 3 cut(s) 161, 249, 453
Tru9I TTAA 3 cut(s) 161, 249, 453
TscAI CASTG 4 cut(s) 52, 82, 409, 516
TseFI GTSAC 1 cut(s) 20
Tsp45I GTSAC 1 cut(s) 20
TspDTI ATGAA 1 cut(s) 262
TspRI CASTG 4 cut(s) 52, 82, 409, 516
VpaK11BI GGWCC 1 cut(s) 119
XapI RAATTY 2 cut(s) 112, 198
XspI CTAG 1 cut(s) 242
Zsp2I ATGCAT 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.