RchiOBHm_Chr2g0119441

Dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
31797982 .. 31798727
746 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 393 bp
ATGTATTGTGATTCTATTACTGATGGAACTTTGGCAACATTCTTGAAGAAGCCTGGAGACTTGGTGGAAGTTGATGAACCAATTGCTCATATTGAAACAGATAAGGTCATAATCGATGTTGCTAGTCCTGAATCTGGTGTAATTGTGAAGTTTGTAGCCAATGAAGGGGATACTGTGGAACCAAGCACCAAGATCATTGTCATACTAAAGTCCAGTGAAGGTGTATCCCATGTGGGTCCATCTGAGAAAACATTGGAGAAAGATGTTCCACAACCAGCTTCCCCTGTAGAAACAATTAGCAAGAATCAAACATCTAAAGTTGTAATAACTCCAGTTACCGAGAAGCCTAAAGCACCATCTCCACCATCTCCTAAACCCTCAGCTCCCCCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

130

Amino Acids

13.69

Weight (kDa)

4.87

Isoelectric Point (pI)

58.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Biotin_lipoyl PF00364 5 - 68 1.6e-14 Biotin-requiring enzyme
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000387)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G26910 AT4G26910 AT4G26910 AT5G55070 AT5G55070
fragaria_vesca FvH4_3g23070 FvH4_3g23070 FvH4_3g23070 FvH4_3g23070 FvH4_6g42960 FvH4_6g42960 FvH4_6g42960 FvH4_6g42960
malus_domestica MD03G1198100.v1.1 MD09G1110700.v1.1 MD17G1098600.v1.1
prunus_persica Prupe.3G215800_v2.0.a1 Prupe.4G216900_v2.0.a1 Prupe.4G216900_v2.0.a1
pyrus_communis pycom03g14960 pycom09g03320 pycom17g09400
rosa_chinensis RchiOBHm_Chr2g0119431 RchiOBHm_Chr2g0119441 RchiOBHm_Chr2g0158941 RchiOBHm_Chr5g0040581 RchiOBHm_Chr5g0052421 RchiOBHm_Chr5g0052431
rosa_laevigata RLG00000002270 RLG00000012296 RLG00000021125 RLG00000031115 RLG00000033989
rosa_multiflora Rmu_co8099772.1_g000001 Rmu_co8181026.1_g000001 Rmu_co8403685.1_g000001 Rmu_sc0001893.1_g000003 Rmu_sc0004787.1_g000003 Rmu_sc0007967.1_g000007 Rmu_sc0010369.1_g000001 Rmu_ssc0000174.1_g000008
rosa_roxburghii Rroxscaffold_1G00040090 Rroxscaffold_1G00040800 Rroxscaffold_1G00049000 Rroxscaffold_2G00090860 Rroxscaffold_2G00122640 Rroxscaffold_2G00127540 Rroxscaffold_2G00128360 Rroxscaffold_3G00249890 Rroxscaffold_4G00314140 Rroxscaffold_5G00345820 Rroxscaffold_5G00345830 Rroxscaffold_5G00371680 Rroxscaffold_7G00164980 Rroxscaffold_7G00209200
rosa_rugosa Rorug01G0153500.1 Rorug02G0473100 Rorug02G0473200 Rorug02G0473200 Rorug03G0343200 Rorug05G0185800
rosa_samantha Rh1AG155300 Rh1AG275400 Rh1BG123600 Rh1CG026200 Rh1CG145600 Rh2AG539600 Rh2BG510900 Rh2BG552500 Rh2CG522900 Rh2DG522600 Rh2DG522700 Rh2DG562200 Rh3CG234300 Rh3CG302000 Rh3CG302100 Rh4DG305100 Rh5AG250900 Rh5AG272600 Rh5AG475300 Rh5BG276800 Rh5BG355700 Rh5CG308700 Rh5DG285400 Rh6BG136500 Rh6BG167900 Rh6BG220000 Rh7AG327600 Rh7AG349200 Rh7AG349300 Rh7AG349400 Rh7AG353200 Rh7CG344900 Rh7CG366500 Rh7CG366600
rosa_wichuraiana Rw1G002110 Rw2G044660 Rw3G008210 Rw4G016310 Rw4G019560 Rw5G025520 Rw5G030020

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 134, 165
AgsI TTSAA 2 cut(s) 46, 95
AjnI CCWGG 1 cut(s) 52
AluBI AGCT 2 cut(s) 278, 383
AluI AGCT 2 cut(s) 278, 383
Alw26I GTCTC 1 cut(s) 51
AspS9I GGNCC 1 cut(s) 236
AvaII GGWCC 1 cut(s) 236
BbvCI CCTCAGC 1 cut(s) 379
BccI CCATC 4 cut(s) 17, 247, 364, 373
BciT130I CCWGG 1 cut(s) 54
BciVI GTATCC 2 cut(s) 163, 235
BcoDI GTCTC 1 cut(s) 51
BfaI CTAG 1 cut(s) 123
BfmI CTRYAG 1 cut(s) 285
BfuI GTATCC 2 cut(s) 163, 235
Bme1390I CCNGG 1 cut(s) 54
Bme18I GGWCC 1 cut(s) 236
BmgT120I GGNCC 1 cut(s) 236
BmiI GGNNCC 2 cut(s) 180, 237
BmrFI CCNGG 1 cut(s) 54
BpmI CTGGAG 2 cut(s) 75, 315
Bpu10I CCTNAGC 1 cut(s) 379
Bsa29I ATCGAT 1 cut(s) 114
BsaXI ACNNNNNCTCC 2 cut(s) 48, 78
Bsc4I CCNNNNNNNGG 2 cut(s) 134, 165
Bse1I ACTGG 2 cut(s) 213, 332
BseBI CCWGG 1 cut(s) 54
BseCI ATCGAT 1 cut(s) 114
BseLI CCNNNNNNNGG 2 cut(s) 134, 165
BseMII CTCAG 2 cut(s) 234, 393
BseNI ACTGG 2 cut(s) 213, 332
BshVI ATCGAT 1 cut(s) 114
BslI CCNNNNNNNGG 2 cut(s) 134, 165
BsmAI GTCTC 1 cut(s) 51
Bsp143I GATC 1 cut(s) 192
BspCNI CTCAG 2 cut(s) 235, 392
BspDI ATCGAT 1 cut(s) 114
BspLI GGNNCC 2 cut(s) 180, 237
BsrI ACTGG 2 cut(s) 213, 332
BssMI GATC 1 cut(s) 192
Bst2UI CCWGG 1 cut(s) 54
Bst4CI ACNGT 1 cut(s) 175
BstDEI CTNAG 2 cut(s) 243, 379
BstKTI GATC 1 cut(s) 195
BstMAI GTCTC 1 cut(s) 51
BstMBI GATC 1 cut(s) 192
BstNI CCWGG 1 cut(s) 54
BstSCI CCNGG 1 cut(s) 52
BstSFI CTRYAG 1 cut(s) 285
Bsu15I ATCGAT 1 cut(s) 114
BsuI GTATCC 2 cut(s) 163, 235
BsuTUI ATCGAT 1 cut(s) 114
BtsIMutI CAGTG 1 cut(s) 220
Cfr13I GGNCC 1 cut(s) 236
ClaI ATCGAT 1 cut(s) 114
CviAII CATG 1 cut(s) 230
CviJI RGCY 5 cut(s) 52, 158, 278, 346, 383
CviKI_1 RGCY 5 cut(s) 52, 158, 278, 346, 383
DdeI CTNAG 2 cut(s) 243, 379
DpnI GATC 1 cut(s) 194
DpnII GATC 1 cut(s) 192
Eco47I GGWCC 1 cut(s) 236
EcoRII CCWGG 1 cut(s) 52
FaeI CATG 1 cut(s) 233
FaiI YATR 4 cut(s) 90, 110, 203, 231
FatI CATG 1 cut(s) 229
FspBI CTAG 1 cut(s) 123
GsuI CTGGAG 2 cut(s) 75, 315
Hin1II CATG 1 cut(s) 233
HinfI GANTC 3 cut(s) 11, 131, 304
Hpy188I TCNGA 1 cut(s) 244
Hpy188III TCNNGA 2 cut(s) 43, 128
HpyAV CCTTC 2 cut(s) 158, 212
HpyCH4III ACNGT 1 cut(s) 175
HpyF3I CTNAG 2 cut(s) 243, 379
Hsp92II CATG 1 cut(s) 233
Kzo9I GATC 1 cut(s) 192
LmnI GCTCC 1 cut(s) 388
LpnPI CCDG 8 cut(s) 39, 66, 120, 141, 226, 288, 297, 345
MaeI CTAG 1 cut(s) 123
MaeIII GTNAC 1 cut(s) 334
MalI GATC 1 cut(s) 194
MboI GATC 1 cut(s) 192
MboII GAAGA 1 cut(s) 58
MfeI CAATTG 1 cut(s) 81
MluCI AATT 3 cut(s) 81, 141, 294
MnlI CCTC 1 cut(s) 388
MspR9I CCNGG 1 cut(s) 54
MunI CAATTG 1 cut(s) 81
MvaI CCWGG 1 cut(s) 54
NdeII GATC 1 cut(s) 192
NlaIII CATG 1 cut(s) 233
NlaIV GGNNCC 2 cut(s) 180, 237
PfeI GAWTC 3 cut(s) 11, 131, 304
Psp6I CCWGG 1 cut(s) 52
PspGI CCWGG 1 cut(s) 52
PspN4I GGNNCC 2 cut(s) 180, 237
PspPI GGNCC 1 cut(s) 236
Sau3AI GATC 1 cut(s) 192
Sau96I GGNCC 1 cut(s) 236
ScrFI CCNGG 1 cut(s) 54
SetI ASST 4 cut(s) 108, 223, 280, 385
SfcI CTRYAG 1 cut(s) 285
SinI GGWCC 1 cut(s) 236
Sse9I AATT 3 cut(s) 81, 141, 294
SspMI CTAG 1 cut(s) 123
StyD4I CCNGG 1 cut(s) 52
TaaI ACNGT 1 cut(s) 175
TaqI TCGA 1 cut(s) 114
TasI AATT 3 cut(s) 81, 141, 294
TfiI GAWTC 3 cut(s) 11, 131, 304
TscAI CASTG 1 cut(s) 220
TspDTI ATGAA 2 cut(s) 90, 177
TspRI CASTG 1 cut(s) 220
VpaK11BI GGWCC 1 cut(s) 236
XspI CTAG 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.