RchiOBHm_Chr2g0133111

Mitogen-activated protein kinase kinase kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
49796415 .. 49796719
305 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50431

Sequence Viewer

Length: 150 bp
ATGGAGCAAAAAATTCCTGATACGTTCTCGAGTCAAGCTAAGGATTTTCTACAGCTTTGCCTAGCTACGGTTCCTGAGCAAAGGTGGACAGCTGAAGACCTTCAATCTCATCCCTTCGTGGCAAATCTTGAATTAGATAGTGATAATTGA

Protein Analysis

49

Amino Acids

5.61

Weight (kDa)

4.16

Isoelectric Point (pI)

73.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 12
AcuI CTGAAG 1 cut(s) 114
AfiI CCNNNNNNNGG 1 cut(s) 67
AgsI TTSAA 2 cut(s) 104, 131
AluBI AGCT 4 cut(s) 38, 55, 65, 92
AluI AGCT 4 cut(s) 38, 55, 65, 92
Ama87I CYCGRG 1 cut(s) 28
ApoI RAATTY 1 cut(s) 12
Asp700I GAANNNNTTC 1 cut(s) 99
AvaI CYCGRG 1 cut(s) 28
BbsI GAAGAC 1 cut(s) 102
BfaI CTAG 1 cut(s) 62
BfmI CTRYAG 1 cut(s) 50
BmeT110I CYCGRG 1 cut(s) 28
BmiI GGNNCC 1 cut(s) 72
BpiI GAAGAC 1 cut(s) 102
Bpu10I CCTNAGC 2 cut(s) 39, 75
Bsc4I CCNNNNNNNGG 1 cut(s) 67
BseGI GGATG 1 cut(s) 109
BseLI CCNNNNNNNGG 1 cut(s) 67
BseMII CTCAG 1 cut(s) 66
BsiHKCI CYCGRG 1 cut(s) 28
BslI CCNNNNNNNGG 1 cut(s) 67
BsoBI CYCGRG 1 cut(s) 28
BspCNI CTCAG 1 cut(s) 67
BspLI GGNNCC 1 cut(s) 72
Bst4CI ACNGT 1 cut(s) 70
BstDEI CTNAG 2 cut(s) 39, 75
BstF5I GGATG 1 cut(s) 109
BstSFI CTRYAG 1 cut(s) 50
BstV2I GAAGAC 1 cut(s) 102
BtsCI GGATG 1 cut(s) 109
CviJI RGCY 4 cut(s) 38, 55, 65, 92
CviKI_1 RGCY 4 cut(s) 38, 55, 65, 92
DdeI CTNAG 2 cut(s) 39, 75
Eco57I CTGAAG 1 cut(s) 114
Eco88I CYCGRG 1 cut(s) 28
FokI GGATG 1 cut(s) 96
FspBI CTAG 1 cut(s) 62
HinfI GANTC 1 cut(s) 31
Hpy166II GTNNAC 1 cut(s) 87
Hpy188III TCNNGA 4 cut(s) 17, 28, 74, 128
Hpy8I GTNNAC 1 cut(s) 87
HpyAV CCTTC 2 cut(s) 110, 124
HpyCH4III ACNGT 1 cut(s) 70
HpyCH4IV ACGT 1 cut(s) 23
HpyF3I CTNAG 2 cut(s) 39, 75
HpySE526I ACGT 1 cut(s) 23
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 2 cut(s) 30, 87
MaeI CTAG 1 cut(s) 62
MaeII ACGT 1 cut(s) 23
MboII GAAGA 1 cut(s) 107
MluCI AATT 3 cut(s) 12, 131, 145
MlyI GAGTC 1 cut(s) 40
MroXI GAANNNNTTC 1 cut(s) 99
MspA1I CMGCKG 1 cut(s) 92
NlaIV GGNNCC 1 cut(s) 72
PaeR7I CTCGAG 1 cut(s) 28
PdmI GAANNNNTTC 1 cut(s) 99
PleI GAGTC 1 cut(s) 39
PpsI GAGTC 1 cut(s) 39
PspN4I GGNNCC 1 cut(s) 72
PvuII CAGCTG 1 cut(s) 92
SchI GAGTC 1 cut(s) 40
SetI ASST 7 cut(s) 26, 40, 57, 67, 86, 94, 102
SfcI CTRYAG 1 cut(s) 50
Sfr274I CTCGAG 1 cut(s) 28
SgeI CNNG 8 cut(s) 29, 40, 42, 47, 74, 86, 130, 140
SlaI CTCGAG 1 cut(s) 28
SmlI CTYRAG 1 cut(s) 28
SmoI CTYRAG 1 cut(s) 28
Sse9I AATT 3 cut(s) 12, 131, 145
SspMI CTAG 1 cut(s) 62
TaaI ACNGT 1 cut(s) 70
TaiI ACGT 1 cut(s) 26
TaqI TCGA 1 cut(s) 29
TasI AATT 3 cut(s) 12, 131, 145
XapI RAATTY 1 cut(s) 12
XhoI CTCGAG 1 cut(s) 28
XmnI GAANNNNTTC 1 cut(s) 99
XspI CTAG 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.