RchiOBHm_Chr3g0473541

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0000552
Physical Location & Seq
Forward (+)
19355828 .. 19357147
1320 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ43920

Sequence Viewer

Length: 162 bp
ATGATGTCAGAGTCAGAGGCTTCACTTATGATTTTGGACATGATTGTGGTGGAACCTAATTACCATAGTGCCTTCCATGATGGCATCACTGTGGGTAACCTTGTGAAAGTTACTTTTATGAATGACATCAAGAACTTCTCAGTTTATTGGGTTAGTGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

6.01

Weight (kDa)

4.57

Isoelectric Point (pI)

20.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000552)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G36250 AT2G36250 AT2G36250 AT2G36250 AT3G52750 AT3G52750 AT3G52750 AT3G52750
fragaria_vesca FvH4_6g18610 FvH4_6g18610 FvH4_6g18610 FvH4_6g18610
malus_domestica MD12G1035600.v1.1 MD14G1022400.v1.1
prunus_persica Prupe.7G110900_v2.0.a1 Prupe.7G110900_v2.0.a1
pyrus_communis pycom12g02340 pycom14g02140
rosa_chinensis RchiOBHm_Chr3g0473191 RchiOBHm_Chr3g0473221 RchiOBHm_Chr3g0473231 RchiOBHm_Chr3g0473301 RchiOBHm_Chr3g0473311 RchiOBHm_Chr3g0473351 RchiOBHm_Chr3g0473401 RchiOBHm_Chr3g0473491 RchiOBHm_Chr3g0473541 RchiOBHm_Chr5g0044451 RchiOBHm_Chr7g0190991
rosa_laevigata RLG00000019977 RLG00000024009 RLG00000024012 RLG00000024015 RLG00000024018 RLG00000024019 RLG00000024021 RLG00000030788
rosa_multiflora Rmu_sc0000327.1_g000039 Rmu_sc0002075.1_g000002 Rmu_sc0003069.1_g000018 Rmu_sc0003069.1_g000050 Rmu_sc0003069.1_g000058 Rmu_sc0006792.1_g000029 Rmu_sc0011598.1_g000001 Rmu_sc0016164.1_g000018
rosa_roxburghii Rroxscaffold_2G00102410 Rroxscaffold_2G00102420 Rroxscaffold_4G00324300 Rroxscaffold_6G00408060 Rroxscaffold_6G00408100 Rroxscaffold_6G00408130 Rroxscaffold_6G00408200 Rroxscaffold_6G00408220 Rroxscaffold_6G00408230
rosa_rugosa Rorug03G0132100 Rorug03G0132500 Rorug03G0132600 Rorug03G0132900 Rorug05G0214500 Rorug06G0144900
rosa_samantha Rh3AG183800 Rh3AG184500 Rh3BG210300 Rh3BG210500 Rh3BG210800 Rh3BG211200 Rh3BG211600 Rh3BG211800 Rh3BG212000 Rh3BG212200 Rh3BG212400 Rh3BG212500 Rh3CG207400 Rh3CG207500 Rh3CG207700 Rh3CG209100 Rh3DG207400 Rh3DG208500 Rh5BG305900 Rh5DG315200
rosa_wichuraiana Rw0G008130 Rw0G008180 Rw0G014760

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
BccI CCATC 1 cut(s) 74
BmiI GGNNCC 1 cut(s) 54
BmsI GCATC 1 cut(s) 93
BseMII CTCAG 1 cut(s) 153
BspCNI CTCAG 1 cut(s) 152
BspLI GGNNCC 1 cut(s) 54
Bst4CI ACNGT 1 cut(s) 91
BstDEI CTNAG 1 cut(s) 139
BstEII GGTNACC 1 cut(s) 95
BstPI GGTNACC 1 cut(s) 95
BtsIMutI CAGTG 1 cut(s) 87
CviAII CATG 2 cut(s) 40, 77
CviJI RGCY 1 cut(s) 20
CviKI_1 RGCY 1 cut(s) 20
DdeI CTNAG 1 cut(s) 139
Eco91I GGTNACC 1 cut(s) 95
EcoO65I GGTNACC 1 cut(s) 95
FaeI CATG 2 cut(s) 43, 80
FaiI YATR 5 cut(s) 29, 41, 66, 78, 119
FatI CATG 2 cut(s) 39, 76
Hin1II CATG 2 cut(s) 43, 80
HinfI GANTC 1 cut(s) 11
Hpy188I TCNGA 2 cut(s) 10, 16
Hpy188III TCNNGA 1 cut(s) 130
HpyAV CCTTC 1 cut(s) 82
HpyCH4III ACNGT 1 cut(s) 91
HpyF3I CTNAG 1 cut(s) 139
Hsp92II CATG 2 cut(s) 43, 80
LweI GCATC 1 cut(s) 93
MaeIII GTNAC 2 cut(s) 95, 109
MluCI AATT 1 cut(s) 58
MlyI GAGTC 1 cut(s) 20
MnlI CCTC 1 cut(s) 10
MslI CAYNNNNRTG 2 cut(s) 44, 89
NlaIII CATG 2 cut(s) 43, 80
NlaIV GGNNCC 1 cut(s) 54
PleI GAGTC 1 cut(s) 19
PpsI GAGTC 1 cut(s) 19
PspEI GGTNACC 1 cut(s) 95
PspN4I GGNNCC 1 cut(s) 54
RseI CAYNNNNRTG 2 cut(s) 44, 89
SchI GAGTC 1 cut(s) 20
SetI ASST 2 cut(s) 58, 102
SfaNI GCATC 1 cut(s) 93
SgeI CNNG 4 cut(s) 52, 89, 113, 142
SmiMI CAYNNNNRTG 2 cut(s) 44, 89
Sse9I AATT 1 cut(s) 58
TaaI ACNGT 1 cut(s) 91
TasI AATT 1 cut(s) 58
TscAI CASTG 1 cut(s) 94
TspDTI ATGAA 1 cut(s) 134
TspRI CASTG 1 cut(s) 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.