Rmu_co8195818.1_g000001

3-isopropylmalate

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8195818.1
Physical Location & Seq
Forward (+)
1 .. 621
621 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8195818.1_g000001.1.cds

Sequence Viewer

Length: 336 bp
gtcaagacgggaatgacgatgaccgagaaaatattggctagggcttctgagaaaacccatttgagccaaggtgacaatgtttgggttaacattgatgttctgatgacccatgatgtctgtggccctggttcctttggaatcttcaagaaagagtttggccagaatgctaaggtttgggatcgagaaaagattgtagtcatacctgaccattatatattcactactgatgagcgtgcaaaccgtaatgtggataccttgagggatttctgcacggagcagaacatcaagtacttctatgatatcaaggatcttggtaactttcaggtgtggatttga

Protein Analysis

111

Amino Acids

12.9

Weight (kDa)

5.88

Isoelectric Point (pI)

25.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 186, 315
AcoI YGGCCR 1 cut(s) 157
AfaI GTAC 1 cut(s) 290
AfiI CCNNNNNNNGG 1 cut(s) 247
AgsI TTSAA 1 cut(s) 145
AjnI CCWGG 1 cut(s) 124
AlwI GGATC 2 cut(s) 186, 315
AoxI GGCC 2 cut(s) 121, 157
AspS9I GGNCC 1 cut(s) 122
AsuHPI GGTGA 1 cut(s) 83
BalI TGGCCA 1 cut(s) 159
BciT130I CCWGG 1 cut(s) 126
BciVI GTATCC 1 cut(s) 244
BfaI CTAG 1 cut(s) 39
BfuI GTATCC 1 cut(s) 244
BmcAI AGTACT 1 cut(s) 290
Bme1390I CCNGG 1 cut(s) 126
BmgT120I GGNCC 1 cut(s) 122
BmiI GGNNCC 1 cut(s) 130
BmrFI CCNGG 1 cut(s) 126
Bpu10I CCTNAGC 1 cut(s) 168
BpuEI CTTGAG 1 cut(s) 277
BsaJI CCNNGG 2 cut(s) 67, 124
Bsc4I CCNNNNNNNGG 1 cut(s) 247
BseBI CCWGG 1 cut(s) 126
BseDI CCNNGG 2 cut(s) 67, 124
BseLI CCNNNNNNNGG 1 cut(s) 247
BseMII CTCAG 1 cut(s) 39
BsgI GTGCAG 1 cut(s) 253
BshFI GGCC 2 cut(s) 123, 159
BslI CCNNNNNNNGG 1 cut(s) 247
BsmI GAATGC 1 cut(s) 169
BsnI GGCC 2 cut(s) 123, 159
Bsp143I GATC 2 cut(s) 178, 307
BspANI GGCC 2 cut(s) 123, 159
BspCNI CTCAG 1 cut(s) 40
BspLI GGNNCC 1 cut(s) 130
BspPI GGATC 2 cut(s) 186, 315
BssECI CCNNGG 2 cut(s) 67, 124
BssMI GATC 2 cut(s) 178, 307
BssT1I CCWWGG 1 cut(s) 67
Bst2UI CCWGG 1 cut(s) 126
Bst4CI ACNGT 1 cut(s) 242
BstC8I GCNNGC 1 cut(s) 234
BstDEI CTNAG 2 cut(s) 48, 168
BstKTI GATC 2 cut(s) 181, 310
BstMBI GATC 2 cut(s) 178, 307
BstNI CCWGG 1 cut(s) 126
BstSCI CCNGG 1 cut(s) 124
BstX2I RGATCY 1 cut(s) 307
BstYI RGATCY 1 cut(s) 307
BsuI GTATCC 1 cut(s) 244
BsuRI GGCC 2 cut(s) 123, 159
Cac8I GCNNGC 1 cut(s) 234
Cfr13I GGNCC 1 cut(s) 122
Csp6I GTAC 1 cut(s) 289
CviAII CATG 1 cut(s) 110
CviJI RGCY 5 cut(s) 38, 44, 66, 123, 159
CviKI_1 RGCY 5 cut(s) 38, 44, 66, 123, 159
CviQI GTAC 1 cut(s) 289
DdeI CTNAG 2 cut(s) 48, 168
DpnI GATC 2 cut(s) 180, 309
DpnII GATC 2 cut(s) 178, 307
EaeI YGGCCR 1 cut(s) 157
Eco130I CCWWGG 1 cut(s) 67
Eco32I GATATC 1 cut(s) 301
EcoRII CCWGG 1 cut(s) 124
EcoRV GATATC 1 cut(s) 301
EcoT14I CCWWGG 1 cut(s) 67
ErhI CCWWGG 1 cut(s) 67
FaeI CATG 1 cut(s) 113
FaiI YATR 5 cut(s) 111, 200, 213, 215, 297
FatI CATG 1 cut(s) 109
FspBI CTAG 1 cut(s) 39
HaeIII GGCC 2 cut(s) 123, 159
Hin1II CATG 1 cut(s) 113
HincII GTYRAC 1 cut(s) 88
HindII GTYRAC 1 cut(s) 88
HinfI GANTC 1 cut(s) 138
HpaI GTTAAC 1 cut(s) 88
HphI GGTGA 1 cut(s) 83
Hpy166II GTNNAC 1 cut(s) 88
Hpy188I TCNGA 2 cut(s) 49, 102
Hpy188III TCNNGA 3 cut(s) 4, 145, 182
Hpy8I GTNNAC 1 cut(s) 88
HpyCH4III ACNGT 1 cut(s) 242
HpyCH4V TGCA 2 cut(s) 236, 270
HpyF3I CTNAG 2 cut(s) 48, 168
Hsp92II CATG 1 cut(s) 113
KspAI GTTAAC 1 cut(s) 88
Kzo9I GATC 2 cut(s) 178, 307
LmnI GCTCC 1 cut(s) 274
LpnPI CCDG 5 cut(s) 111, 138, 173, 216, 308
MaeI CTAG 1 cut(s) 39
MaeIII GTNAC 2 cut(s) 71, 314
MalI GATC 2 cut(s) 180, 309
MboI GATC 2 cut(s) 178, 307
MboII GAAGA 1 cut(s) 133
MflI RGATCY 1 cut(s) 307
MlsI TGGCCA 1 cut(s) 159
MluNI TGGCCA 1 cut(s) 159
MnlI CCTC 1 cut(s) 252
Mox20I TGGCCA 1 cut(s) 159
MscI TGGCCA 1 cut(s) 159
MseI TTAA 1 cut(s) 87
Msp20I TGGCCA 1 cut(s) 159
MspR9I CCNGG 1 cut(s) 126
Mva1269I GAATGC 1 cut(s) 169
MvaI CCWGG 1 cut(s) 126
NdeII GATC 2 cut(s) 178, 307
NlaIII CATG 1 cut(s) 113
NlaIV GGNNCC 1 cut(s) 130
NmuCI GTSAC 1 cut(s) 71
PcsI WCGNNNNNNNCGW 1 cut(s) 14
PctI GAATGC 1 cut(s) 169
PfeI GAWTC 1 cut(s) 138
Psp6I CCWGG 1 cut(s) 124
PspGI CCWGG 1 cut(s) 124
PspN4I GGNNCC 1 cut(s) 130
PspPI GGNCC 1 cut(s) 122
PsrI GAACNNNNNNTAC 2 cut(s) 272, 304
PsuI RGATCY 1 cut(s) 307
RsaI GTAC 1 cut(s) 290
RsaNI GTAC 1 cut(s) 289
SaqAI TTAA 1 cut(s) 87
Sau3AI GATC 2 cut(s) 178, 307
Sau96I GGNCC 1 cut(s) 122
ScaI AGTACT 1 cut(s) 290
ScrFI CCNGG 1 cut(s) 126
SetI ASST 5 cut(s) 73, 174, 205, 257, 327
SmlI CTYRAG 1 cut(s) 256
SmoI CTYRAG 1 cut(s) 256
SspI AATATT 1 cut(s) 33
SspMI CTAG 1 cut(s) 39
StyD4I CCNGG 1 cut(s) 124
StyI CCWWGG 1 cut(s) 67
TaaI ACNGT 1 cut(s) 242
TaqI TCGA 1 cut(s) 181
TaqII GACCGA 1 cut(s) 38
TatI WGTACW 1 cut(s) 288
TfiI GAWTC 1 cut(s) 138
Tru1I TTAA 1 cut(s) 87
Tru9I TTAA 1 cut(s) 87
TseFI GTSAC 1 cut(s) 71
Tsp45I GTSAC 1 cut(s) 71
TspGWI ACGGA 1 cut(s) 287
XcmI CCANNNNNNNNNTGG 1 cut(s) 116
XspI CTAG 1 cut(s) 39
ZrmI AGTACT 1 cut(s) 290
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.