Rmu_sc0039027.1_g000001

3-isopropylmalate

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0039027.1
Physical Location & Seq
Reverse (-)
2 .. 516
515 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0039027.1_g000001.1.cds

Sequence Viewer

Length: 346 bp
atgggttactccactgttgctccaccctccacctccttcatcaacaacaccaccaagaaggatttgggtctctctgctttctcttccacgtcgctggcttcatttccgagatgcaagagatcactttccaagaaaatctgctccgtcatatcgccacagcaatcggagcggaagccagccactactggctcggtcaagacgggaatgacaatgacggagaagatattggctagggcttctgagaaaccccaattgagcccaggtggcaatgtttgggttaacattgatgttttgatgacccatgacgtgtgtggccctggttcatttggaatcttcaagaaagagt

Protein Analysis

115

Amino Acids

12.29

Weight (kDa)

9.77

Isoelectric Point (pI)

43.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 169
AciI CCGC 1 cut(s) 169
AflIII ACRYGT 1 cut(s) 306
AgsI TTSAA 1 cut(s) 337
AjiI CACGTC 2 cut(s) 90, 307
AjnI CCWGG 2 cut(s) 259, 316
Alw26I GTCTC 1 cut(s) 74
AoxI GGCC 1 cut(s) 313
AspS9I GGNCC 1 cut(s) 314
BanII GRGCYC 1 cut(s) 260
BciT130I CCWGG 2 cut(s) 261, 318
BcoDI GTCTC 1 cut(s) 74
BfaI CTAG 1 cut(s) 231
BglI GCCNNNNNGGC 1 cut(s) 264
Bme1390I CCNGG 2 cut(s) 261, 318
BmgBI CACGTC 2 cut(s) 90, 307
BmgT120I GGNCC 1 cut(s) 314
BmrFI CCNGG 2 cut(s) 261, 318
BmsI GCATC 1 cut(s) 101
BsaI GGTCTC 1 cut(s) 74
BsaJI CCNNGG 2 cut(s) 259, 316
BsaXI ACNNNNNCTCC 1 cut(s) 34
Bse1I ACTGG 1 cut(s) 190
Bse3DI GCAATG 1 cut(s) 274
BseBI CCWGG 2 cut(s) 261, 318
BseDI CCNNGG 2 cut(s) 259, 316
BseMI GCAATG 1 cut(s) 274
BseMII CTCAG 1 cut(s) 231
BseNI ACTGG 1 cut(s) 190
BshFI GGCC 1 cut(s) 315
BsmAI GTCTC 1 cut(s) 74
BsnI GGCC 1 cut(s) 315
Bso31I GGTCTC 1 cut(s) 74
Bsp1286I GDGCHC 1 cut(s) 260
Bsp143I GATC 1 cut(s) 119
BspACI CCGC 1 cut(s) 169
BspANI GGCC 1 cut(s) 315
BspCNI CTCAG 1 cut(s) 232
BspTNI GGTCTC 1 cut(s) 74
BsrBI CCGCTC 1 cut(s) 169
BsrDI GCAATG 1 cut(s) 274
BsrI ACTGG 1 cut(s) 190
BssECI CCNNGG 2 cut(s) 259, 316
BssMI GATC 1 cut(s) 119
Bst2UI CCWGG 2 cut(s) 261, 318
Bst4CI ACNGT 1 cut(s) 16
Bst6I CTCTTC 1 cut(s) 88
BstC8I GCNNGC 2 cut(s) 96, 177
BstDEI CTNAG 1 cut(s) 240
BstKTI GATC 1 cut(s) 122
BstMAI GTCTC 1 cut(s) 74
BstMBI GATC 1 cut(s) 119
BstMWI GCNNNNNNNGC 2 cut(s) 166, 264
BstNI CCWGG 2 cut(s) 261, 318
BstSCI CCNGG 2 cut(s) 259, 316
BstXI CCANNNNNNTGG 1 cut(s) 94
BsuRI GGCC 1 cut(s) 315
BtrI CACGTC 2 cut(s) 90, 307
BtsIMutI CAGTG 1 cut(s) 12
Cac8I GCNNGC 2 cut(s) 96, 177
Cfr13I GGNCC 1 cut(s) 314
CviAII CATG 1 cut(s) 302
CviJI RGCY 8 cut(s) 98, 175, 179, 189, 230, 236, 258, 315
CviKI_1 RGCY 8 cut(s) 98, 175, 179, 189, 230, 236, 258, 315
DdeI CTNAG 1 cut(s) 240
DpnI GATC 1 cut(s) 121
DpnII GATC 1 cut(s) 119
Eam1104I CTCTTC 1 cut(s) 88
EarI CTCTTC 1 cut(s) 88
Eco24I GRGCYC 1 cut(s) 260
Eco31I GGTCTC 1 cut(s) 74
EcoRII CCWGG 2 cut(s) 259, 316
EcoT38I GRGCYC 1 cut(s) 260
FaeI CATG 1 cut(s) 305
FaiI YATR 2 cut(s) 149, 303
FatI CATG 1 cut(s) 301
FriOI GRGCYC 1 cut(s) 260
FspBI CTAG 1 cut(s) 231
HaeIII GGCC 1 cut(s) 315
Hin1II CATG 1 cut(s) 305
HincII GTYRAC 1 cut(s) 280
HindII GTYRAC 1 cut(s) 280
HinfI GANTC 1 cut(s) 330
HpaI GTTAAC 1 cut(s) 280
Hpy166II GTNNAC 1 cut(s) 280
Hpy188I TCNGA 3 cut(s) 108, 166, 241
Hpy188III TCNNGA 2 cut(s) 196, 337
Hpy8I GTNNAC 1 cut(s) 280
Hpy99I CGWCG 1 cut(s) 94
HpyAV CCTTC 2 cut(s) 46, 52
HpyCH4III ACNGT 1 cut(s) 16
HpyCH4IV ACGT 2 cut(s) 89, 306
HpyCH4V TGCA 1 cut(s) 114
HpyF10VI GCNNNNNNNGC 2 cut(s) 166, 264
HpyF3I CTNAG 1 cut(s) 240
HpySE526I ACGT 2 cut(s) 89, 306
Hsp92II CATG 1 cut(s) 305
KspAI GTTAAC 1 cut(s) 280
Kzo9I GATC 1 cut(s) 119
LmnI GCTCC 3 cut(s) 25, 146, 166
LpnPI CCDG 7 cut(s) 80, 171, 189, 246, 273, 303, 330
LweI GCATC 1 cut(s) 101
MaeI CTAG 1 cut(s) 231
MaeII ACGT 2 cut(s) 89, 306
MaeIII GTNAC 1 cut(s) 5
MalI GATC 1 cut(s) 121
MbiI CCGCTC 1 cut(s) 169
MboI GATC 1 cut(s) 119
MboII GAAGA 3 cut(s) 75, 232, 325
MfeI CAATTG 1 cut(s) 251
MhlI GDGCHC 1 cut(s) 260
MluCI AATT 1 cut(s) 251
MnlI CCTC 2 cut(s) 37, 43
MseI TTAA 1 cut(s) 279
MspR9I CCNGG 2 cut(s) 261, 318
MunI CAATTG 1 cut(s) 251
MvaI CCWGG 2 cut(s) 261, 318
MwoI GCNNNNNNNGC 2 cut(s) 166, 264
NdeII GATC 1 cut(s) 119
NlaIII CATG 1 cut(s) 305
PfeI GAWTC 1 cut(s) 330
Psp6I CCWGG 2 cut(s) 259, 316
PspGI CCWGG 2 cut(s) 259, 316
PspPI GGNCC 1 cut(s) 314
SaqAI TTAA 1 cut(s) 279
Sau3AI GATC 1 cut(s) 119
Sau96I GGNCC 1 cut(s) 314
ScrFI CCNGG 2 cut(s) 261, 318
SduI GDGCHC 1 cut(s) 260
SetI ASST 4 cut(s) 35, 92, 265, 309
SfaNI GCATC 1 cut(s) 101
Sse9I AATT 1 cut(s) 251
SsiI CCGC 1 cut(s) 169
SspMI CTAG 1 cut(s) 231
StyD4I CCNGG 2 cut(s) 259, 316
TaaI ACNGT 1 cut(s) 16
TaiI ACGT 2 cut(s) 92, 309
TaqII GACCGA 1 cut(s) 181
TasI AATT 1 cut(s) 251
TfiI GAWTC 1 cut(s) 330
Tru1I TTAA 1 cut(s) 279
Tru9I TTAA 1 cut(s) 279
TscAI CASTG 1 cut(s) 19
TspDTI ATGAA 3 cut(s) 28, 90, 312
TspGWI ACGGA 2 cut(s) 133, 230
TspRI CASTG 1 cut(s) 19
XcmI CCANNNNNNNNNTGG 2 cut(s) 61, 308
XspI CTAG 1 cut(s) 231
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.