Rmu_sc0001669.1_g000055

3-isopropylmalate

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001669.1
Physical Location & Seq
Forward (+)
242440 .. 242819
380 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001669.1_g000055.1.cds

Sequence Viewer

Length: 291 bp
ctggcttcatttccgagatgcaagagatcactttccaagaaaatctgctccgtcatatcgccacagcaatcggagcggaagccagccactactggctcggtcaagacgggaatgacaatgacggagaagatattggctagggcttctgagaaaccccaattgagcccaggtgacaatgtttgggttaacattgatgttttgatgacccatgacgtgtgtggccctggttcatttggaatcttcaagaaagagtttggacagaatgcaaaggtagcttcatttttcagctaa

Protein Analysis

96

Amino Acids

10.44

Weight (kDa)

9.72

Isoelectric Point (pI)

42.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 76
AciI CCGC 1 cut(s) 76
AflIII ACRYGT 1 cut(s) 213
AgsI TTSAA 1 cut(s) 244
AjiI CACGTC 1 cut(s) 214
AjnI CCWGG 2 cut(s) 166, 223
AluBI AGCT 2 cut(s) 275, 288
AluI AGCT 2 cut(s) 275, 288
AoxI GGCC 1 cut(s) 220
AspS9I GGNCC 1 cut(s) 221
AsuHPI GGTGA 1 cut(s) 182
BanII GRGCYC 1 cut(s) 167
BciT130I CCWGG 2 cut(s) 168, 225
BfaI CTAG 1 cut(s) 138
Bme1390I CCNGG 2 cut(s) 168, 225
BmgBI CACGTC 1 cut(s) 214
BmgT120I GGNCC 1 cut(s) 221
BmrFI CCNGG 2 cut(s) 168, 225
BmsI GCATC 1 cut(s) 8
BsaJI CCNNGG 2 cut(s) 166, 223
Bse1I ACTGG 1 cut(s) 97
BseBI CCWGG 2 cut(s) 168, 225
BseDI CCNNGG 2 cut(s) 166, 223
BseMII CTCAG 1 cut(s) 138
BseNI ACTGG 1 cut(s) 97
BshFI GGCC 1 cut(s) 222
BsmI GAATGC 1 cut(s) 268
BsnI GGCC 1 cut(s) 222
Bsp1286I GDGCHC 1 cut(s) 167
Bsp143I GATC 1 cut(s) 26
BspACI CCGC 1 cut(s) 76
BspANI GGCC 1 cut(s) 222
BspCNI CTCAG 1 cut(s) 139
BsrBI CCGCTC 1 cut(s) 76
BsrI ACTGG 1 cut(s) 97
BssECI CCNNGG 2 cut(s) 166, 223
BssMI GATC 1 cut(s) 26
Bst2UI CCWGG 2 cut(s) 168, 225
BstC8I GCNNGC 1 cut(s) 84
BstDEI CTNAG 1 cut(s) 147
BstKTI GATC 1 cut(s) 29
BstMBI GATC 1 cut(s) 26
BstMWI GCNNNNNNNGC 2 cut(s) 73, 272
BstNI CCWGG 2 cut(s) 168, 225
BstSCI CCNGG 2 cut(s) 166, 223
BsuRI GGCC 1 cut(s) 222
BtrI CACGTC 1 cut(s) 214
Cac8I GCNNGC 1 cut(s) 84
Cfr13I GGNCC 1 cut(s) 221
CviAII CATG 1 cut(s) 209
DdeI CTNAG 1 cut(s) 147
DpnI GATC 1 cut(s) 28
DpnII GATC 1 cut(s) 26
Eco24I GRGCYC 1 cut(s) 167
EcoRII CCWGG 2 cut(s) 166, 223
EcoT38I GRGCYC 1 cut(s) 167
FaeI CATG 1 cut(s) 212
FaiI YATR 2 cut(s) 56, 210
FatI CATG 1 cut(s) 208
FriOI GRGCYC 1 cut(s) 167
FspBI CTAG 1 cut(s) 138
HaeIII GGCC 1 cut(s) 222
Hin1II CATG 1 cut(s) 212
HincII GTYRAC 1 cut(s) 187
HindII GTYRAC 1 cut(s) 187
HinfI GANTC 1 cut(s) 237
HpaI GTTAAC 1 cut(s) 187
HphI GGTGA 1 cut(s) 182
Hpy166II GTNNAC 1 cut(s) 187
Hpy188I TCNGA 3 cut(s) 15, 73, 148
Hpy188III TCNNGA 2 cut(s) 103, 244
Hpy8I GTNNAC 1 cut(s) 187
HpyCH4IV ACGT 1 cut(s) 213
HpyCH4V TGCA 2 cut(s) 21, 266
HpyF10VI GCNNNNNNNGC 2 cut(s) 73, 272
HpyF3I CTNAG 1 cut(s) 147
HpySE526I ACGT 1 cut(s) 213
Hsp92II CATG 1 cut(s) 212
KspAI GTTAAC 1 cut(s) 187
Kzo9I GATC 1 cut(s) 26
LmnI GCTCC 2 cut(s) 53, 73
LpnPI CCDG 6 cut(s) 78, 96, 153, 180, 210, 237
LweI GCATC 1 cut(s) 8
MaeI CTAG 1 cut(s) 138
MaeII ACGT 1 cut(s) 213
MaeIII GTNAC 1 cut(s) 170
MalI GATC 1 cut(s) 28
MbiI CCGCTC 1 cut(s) 76
MboI GATC 1 cut(s) 26
MboII GAAGA 2 cut(s) 139, 232
MfeI CAATTG 1 cut(s) 158
MhlI GDGCHC 1 cut(s) 167
MluCI AATT 1 cut(s) 158
MseI TTAA 1 cut(s) 186
MspR9I CCNGG 2 cut(s) 168, 225
MunI CAATTG 1 cut(s) 158
Mva1269I GAATGC 1 cut(s) 268
MvaI CCWGG 2 cut(s) 168, 225
MwoI GCNNNNNNNGC 2 cut(s) 73, 272
NdeII GATC 1 cut(s) 26
NlaIII CATG 1 cut(s) 212
NmuCI GTSAC 1 cut(s) 170
PctI GAATGC 1 cut(s) 268
PfeI GAWTC 1 cut(s) 237
Psp6I CCWGG 2 cut(s) 166, 223
PspGI CCWGG 2 cut(s) 166, 223
PspPI GGNCC 1 cut(s) 221
SaqAI TTAA 1 cut(s) 186
Sau3AI GATC 1 cut(s) 26
Sau96I GGNCC 1 cut(s) 221
ScrFI CCNGG 2 cut(s) 168, 225
SduI GDGCHC 1 cut(s) 167
SetI ASST 5 cut(s) 172, 216, 273, 277, 290
SfaNI GCATC 1 cut(s) 8
Sse9I AATT 1 cut(s) 158
SsiI CCGC 1 cut(s) 76
SspMI CTAG 1 cut(s) 138
StyD4I CCNGG 2 cut(s) 166, 223
TaiI ACGT 1 cut(s) 216
TaqII GACCGA 1 cut(s) 88
TasI AATT 1 cut(s) 158
TfiI GAWTC 1 cut(s) 237
Tru1I TTAA 1 cut(s) 186
Tru9I TTAA 1 cut(s) 186
TseFI GTSAC 1 cut(s) 170
Tsp45I GTSAC 1 cut(s) 170
TspDTI ATGAA 2 cut(s) 219, 267
TspGWI ACGGA 2 cut(s) 40, 137
XcmI CCANNNNNNNNNTGG 1 cut(s) 215
XspI CTAG 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.