Rroxscaffold_2G00122540

Lignin degradation and detoxification of lignin-derived products

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
55721811 .. 55818890
97080 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00122540.1

Sequence Viewer

Length: 297 bp
ATGCACCTTCATGGTTACAGTTTCTATGTGGTTGGATTGGGGCTTGGGAACTTTGACAAGGATAAGGACCCTTTGAAATACAATCTTGTTGATCCTCCTCTTCAAAACACCATTGCTGTCCCTGTAAATGGGTGGACTACCATCAGATTCAAGGCTGACAATCCTGGAGTTTGGTTTATGCATTGCCATCTAGATAGGCATATGTCATGGGGCATGGATACGACATTCATAGTGAAAAATGGAAAGGAACCTGAAGCTCAAATCTTACCTCCACCACCAGATATGCCACCTTGCTGA

Protein Analysis

98

Amino Acids

11.12

Weight (kDa)

6.15

Isoelectric Point (pI)

43.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu-oxidase_2 PF07731 1 - 81 2.1e-33 Multicopper oxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000610)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 86
AcuI CTGAAG 1 cut(s) 273
AfiI CCNNNNNNNGG 1 cut(s) 128
AgsI TTSAA 3 cut(s) 76, 104, 151
AjnI CCWGG 1 cut(s) 163
AluBI AGCT 1 cut(s) 257
AluI AGCT 1 cut(s) 257
AlwI GGATC 1 cut(s) 86
AspS9I GGNCC 1 cut(s) 67
AvaII GGWCC 1 cut(s) 67
BccI CCATC 2 cut(s) 149, 195
BciT130I CCWGG 1 cut(s) 165
BciVI GTATCC 1 cut(s) 211
BfaI CTAG 1 cut(s) 191
BfuI GTATCC 1 cut(s) 211
Bme1390I CCNGG 1 cut(s) 165
Bme18I GGWCC 1 cut(s) 67
BmgT120I GGNCC 1 cut(s) 67
BmiI GGNNCC 2 cut(s) 69, 249
BmrFI CCNGG 1 cut(s) 165
BpmI CTGGAG 1 cut(s) 186
Bsc4I CCNNNNNNNGG 1 cut(s) 128
Bse3DI GCAATG 2 cut(s) 111, 181
BseBI CCWGG 1 cut(s) 165
BseLI CCNNNNNNNGG 1 cut(s) 128
BseMI GCAATG 2 cut(s) 111, 181
BseRI GAGGAG 1 cut(s) 87
BslFI GGGAC 1 cut(s) 104
BslI CCNNNNNNNGG 1 cut(s) 128
BsmFI GGGAC 1 cut(s) 104
Bsp143I GATC 1 cut(s) 91
BspLI GGNNCC 2 cut(s) 69, 249
BspPI GGATC 1 cut(s) 86
BsrDI GCAATG 2 cut(s) 111, 181
BssMI GATC 1 cut(s) 91
Bst2UI CCWGG 1 cut(s) 165
Bst4CI ACNGT 1 cut(s) 20
Bst6I CTCTTC 1 cut(s) 105
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BstNI CCWGG 1 cut(s) 165
BstSCI CCNGG 1 cut(s) 163
BsuI GTATCC 1 cut(s) 211
Cfr13I GGNCC 1 cut(s) 67
CviAII CATG 3 cut(s) 11, 207, 214
CviJI RGCY 3 cut(s) 43, 155, 257
CviKI_1 RGCY 3 cut(s) 43, 155, 257
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
Eam1104I CTCTTC 1 cut(s) 105
EarI CTCTTC 1 cut(s) 105
Eco47I GGWCC 1 cut(s) 67
Eco57I CTGAAG 1 cut(s) 273
EcoO109I RGGNCCY 1 cut(s) 67
EcoRII CCWGG 1 cut(s) 163
EcoT22I ATGCAT 1 cut(s) 183
FaeI CATG 3 cut(s) 14, 210, 217
FaiI YATR 9 cut(s) 12, 27, 179, 201, 203, 208, 215, 230, 284
FaqI GGGAC 1 cut(s) 104
FatI CATG 3 cut(s) 10, 206, 213
FauNDI CATATG 1 cut(s) 201
FspBI CTAG 1 cut(s) 191
GsuI CTGGAG 1 cut(s) 186
Hin1II CATG 3 cut(s) 14, 210, 217
HinfI GANTC 1 cut(s) 147
Hpy166II GTNNAC 1 cut(s) 135
Hpy188I TCNGA 1 cut(s) 146
Hpy188III TCNNGA 1 cut(s) 191
Hpy8I GTNNAC 1 cut(s) 135
HpyAV CCTTC 1 cut(s) 17
HpyCH4III ACNGT 1 cut(s) 20
HpyCH4V TGCA 2 cut(s) 4, 181
Hsp92II CATG 3 cut(s) 14, 210, 217
Kzo9I GATC 1 cut(s) 91
LpnPI CCDG 5 cut(s) 135, 150, 177, 264, 291
MaeI CTAG 1 cut(s) 191
MaeIII GTNAC 1 cut(s) 14
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MboII GAAGA 1 cut(s) 92
MmeI TCCRAC 1 cut(s) 13
MnlI CCTC 3 cut(s) 105, 108, 279
Mph1103I ATGCAT 1 cut(s) 183
MslI CAYNNNNRTG 1 cut(s) 9
MspR9I CCNGG 1 cut(s) 165
MvaI CCWGG 1 cut(s) 165
NdeI CATATG 1 cut(s) 201
NdeII GATC 1 cut(s) 91
NlaIII CATG 3 cut(s) 14, 210, 217
NlaIV GGNNCC 2 cut(s) 69, 249
NsiI ATGCAT 1 cut(s) 183
PfeI GAWTC 1 cut(s) 147
PfoI TCCNGGA 1 cut(s) 163
PpuMI RGGWCCY 1 cut(s) 67
Psp5II RGGWCCY 1 cut(s) 67
Psp6I CCWGG 1 cut(s) 163
PspGI CCWGG 1 cut(s) 163
PspN4I GGNNCC 2 cut(s) 69, 249
PspPI GGNCC 1 cut(s) 67
PspPPI RGGWCCY 1 cut(s) 67
RseI CAYNNNNRTG 1 cut(s) 9
Sau3AI GATC 1 cut(s) 91
Sau96I GGNCC 1 cut(s) 67
ScrFI CCNGG 1 cut(s) 165
SetI ASST 5 cut(s) 9, 253, 259, 271, 292
SinI GGWCC 1 cut(s) 67
SmiMI CAYNNNNRTG 1 cut(s) 9
SspMI CTAG 1 cut(s) 191
StyD4I CCNGG 1 cut(s) 163
TaaI ACNGT 1 cut(s) 20
TfiI GAWTC 1 cut(s) 147
TspDTI ATGAA 1 cut(s) 217
VpaK11BI GGWCC 1 cut(s) 67
XbaI TCTAGA 1 cut(s) 190
XspI CTAG 1 cut(s) 191
Zsp2I ATGCAT 1 cut(s) 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.