AT4G13320

zinc finger

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
OG0001259
Physical Location & Seq
Forward (+)
7753311 .. 7754149
839 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G13320.1

Sequence Viewer

Length: 651 bp
ATGGCCGAAGACAGAAGCAGTAAAATACAAGCCTTGGATATTGAGAGTAACATCGAAAGACGGTTTGAGGAGATGGAGCAAACCCTAATAAGAATTCAACAAGAAGATACTGCTACTAATGAGTCCTCCCAATGGAGACCGCAACCAACAGATTGGAATGCGAGAAACATGACTCCTATCGAGGTTTCCGCGATCTTACTGCATCAAGAAGACAATCATCATCATGATCAACAAACTCAACAAGGTAGTAGTAATACAATAACAAACTTCTTTGACTGGAAACCAGATTTTGTTTTCCGCACACAATGTGTTATCAACGACGAAGCCTGCAGATTGGTCCTCTACGGCGGAAACAACATCATTTCAAAAGGTTTAGTGAAGCAGTTGAAACTCAAGACGCTGAAAAAATATCCATCTGTTAGGGTTATGGCAACGAGAAGAGAGGATAAAGTCGCAGAGGAGACGTGTAGAGTCCCTGTCTCAATCGGAGATTTCTATAAGGACAAAGTTACATGCTATGTAGTCAACATGGAAGAAGAGGAAGATCAACTTCTCTTTGGAGGACCATGGCTTTATCGCGTTCAAGCTACACATAATGGACGAGACGACTCTTGTATGATTATATGGAACCACAACATGATTCTATTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 Retrotrans_gag rve zf-CCHC zf-H2C2

Protein Analysis

216

Amino Acids

25.24

Weight (kDa)

5.3

Isoelectric Point (pI)

60.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 191, 579
AciI CCGC 4 cut(s) 140, 189, 298, 348
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 93
AdeI CACNNNGTG 1 cut(s) 308
AfiI CCNNNNNNNGG 1 cut(s) 132
AflIII ACRYGT 1 cut(s) 464
AgsI TTSAA 4 cut(s) 98, 366, 388, 584
AjiI CACGTC 1 cut(s) 465
AluBI AGCT 1 cut(s) 587
AluI AGCT 1 cut(s) 587
Alw26I GTCTC 4 cut(s) 130, 455, 484, 597
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 93
AspS9I GGNCC 2 cut(s) 337, 563
AvaII GGWCC 2 cut(s) 337, 563
BbsI GAAGAC 2 cut(s) 15, 216
BccI CCATC 2 cut(s) 67, 421
BceAI ACGGC 1 cut(s) 361
BcgI CGANNNNNNTGC 2 cut(s) 181, 215
BclI TGATCA 1 cut(s) 226
BcoDI GTCTC 4 cut(s) 130, 455, 484, 597
BfmI CTRYAG 1 cut(s) 328
Bme18I GGWCC 2 cut(s) 337, 563
BmgBI CACGTC 1 cut(s) 465
BmgT120I GGNCC 2 cut(s) 337, 563
BmiI GGNNCC 1 cut(s) 629
BmsI GCATC 1 cut(s) 211
BpiI GAAGAC 2 cut(s) 15, 216
BpuEI CTTGAG 1 cut(s) 377
BsaI GGTCTC 1 cut(s) 130
BsaJI CCNNGG 2 cut(s) 33, 566
Bsc4I CCNNNNNNNGG 1 cut(s) 132
Bse1I ACTGG 1 cut(s) 281
BseDI CCNNGG 2 cut(s) 33, 566
BseLI CCNNNNNNNGG 1 cut(s) 132
BseNI ACTGG 1 cut(s) 281
BseRI GAGGAG 2 cut(s) 83, 473
Bsh1236I CGCG 2 cut(s) 191, 579
BshFI GGCC 1 cut(s) 5
BslFI GGGAC 1 cut(s) 458
BslI CCNNNNNNNGG 1 cut(s) 132
BsmAI GTCTC 4 cut(s) 130, 455, 484, 597
BsmBI CGTCTC 2 cut(s) 455, 597
BsmFI GGGAC 1 cut(s) 458
BsmI GAATGC 1 cut(s) 163
BsnI GGCC 1 cut(s) 5
Bso31I GGTCTC 1 cut(s) 130
Bsp143I GATC 3 cut(s) 192, 226, 544
Bsp19I CCATGG 1 cut(s) 566
BspACI CCGC 4 cut(s) 140, 189, 298, 348
BspANI GGCC 1 cut(s) 5
BspFNI CGCG 2 cut(s) 191, 579
BspHI TCATGA 1 cut(s) 223
BspLI GGNNCC 1 cut(s) 629
BspMAI CTGCAG 1 cut(s) 332
BspTNI GGTCTC 1 cut(s) 130
BsrI ACTGG 1 cut(s) 281
BssECI CCNNGG 2 cut(s) 33, 566
BssMI GATC 3 cut(s) 192, 226, 544
BssT1I CCWWGG 2 cut(s) 33, 566
Bst4CI ACNGT 1 cut(s) 63
Bst6I CTCTTC 2 cut(s) 433, 531
BstC8I GCNNGC 1 cut(s) 328
BstDSI CCRYGG 1 cut(s) 566
BstFNI CGCG 2 cut(s) 191, 579
BstKTI GATC 3 cut(s) 195, 229, 547
BstMAI GTCTC 4 cut(s) 130, 455, 484, 597
BstMBI GATC 3 cut(s) 192, 226, 544
BstNSI RCATGY 1 cut(s) 516
BstSFI CTRYAG 1 cut(s) 328
BstUI CGCG 2 cut(s) 191, 579
BstV2I GAAGAC 2 cut(s) 15, 216
BstXI CCANNNNNNTGG 1 cut(s) 153
BsuRI GGCC 1 cut(s) 5
BtgI CCRYGG 1 cut(s) 566
BtrI CACGTC 1 cut(s) 465
Cac8I GCNNGC 1 cut(s) 328
CciI TCATGA 1 cut(s) 223
Cfr13I GGNCC 2 cut(s) 337, 563
CseI GACGC 1 cut(s) 406
CviAII CATG 6 cut(s) 169, 224, 513, 529, 567, 637
CviJI RGCY 5 cut(s) 5, 32, 326, 571, 587
CviKI_1 RGCY 5 cut(s) 5, 32, 326, 571, 587
DpnI GATC 3 cut(s) 194, 228, 546
DpnII GATC 3 cut(s) 192, 226, 544
DraIII CACNNNGTG 1 cut(s) 308
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 2 cut(s) 433, 531
EarI CTCTTC 2 cut(s) 433, 531
EciI GGCGGA 1 cut(s) 363
Eco130I CCWWGG 2 cut(s) 33, 566
Eco31I GGTCTC 1 cut(s) 130
Eco47I GGWCC 2 cut(s) 337, 563
EcoRI GAATTC 1 cut(s) 93
EcoT14I CCWWGG 2 cut(s) 33, 566
ErhI CCWWGG 2 cut(s) 33, 566
Esp3I CGTCTC 2 cut(s) 455, 597
FaeI CATG 6 cut(s) 172, 227, 516, 532, 570, 640
FalI AAGNNNNNCTT 2 cut(s) 534, 566
FaqI GGGAC 1 cut(s) 458
FatI CATG 6 cut(s) 168, 223, 512, 528, 566, 636
FbaI TGATCA 1 cut(s) 226
HaeIII GGCC 1 cut(s) 5
HgaI GACGC 1 cut(s) 406
Hin1II CATG 6 cut(s) 172, 227, 516, 532, 570, 640
HincII GTYRAC 1 cut(s) 526
HindII GTYRAC 1 cut(s) 526
HinfI GANTC 5 cut(s) 122, 172, 471, 608, 640
Hpy166II GTNNAC 1 cut(s) 526
Hpy188I TCNGA 1 cut(s) 488
Hpy188III TCNNGA 3 cut(s) 206, 224, 394
Hpy8I GTNNAC 1 cut(s) 526
Hpy99I CGWCG 1 cut(s) 323
HpyCH4III ACNGT 1 cut(s) 63
HpyCH4IV ACGT 1 cut(s) 464
HpyCH4V TGCA 2 cut(s) 202, 330
HpySE526I ACGT 1 cut(s) 464
Hsp92II CATG 6 cut(s) 172, 227, 516, 532, 570, 640
Ksp22I TGATCA 1 cut(s) 226
Kzo9I GATC 3 cut(s) 192, 226, 544
LmnI GCTCC 1 cut(s) 76
LpnPI CCDG 4 cut(s) 262, 297, 340, 489
LweI GCATC 1 cut(s) 211
MaeII ACGT 1 cut(s) 464
MaeIII GTNAC 2 cut(s) 47, 508
MalI GATC 3 cut(s) 194, 228, 546
MboI GATC 3 cut(s) 192, 226, 544
MboII GAAGA 7 cut(s) 20, 116, 221, 450, 545, 548, 554
MluCI AATT 1 cut(s) 93
MlyI GAGTC 4 cut(s) 131, 166, 480, 602
MnlI CCTC 8 cut(s) 61, 136, 175, 350, 436, 451, 532, 554
MslI CAYNNNNRTG 1 cut(s) 222
Mva1269I GAATGC 1 cut(s) 163
MvnI CGCG 2 cut(s) 191, 579
NcoI CCATGG 1 cut(s) 566
NdeII GATC 3 cut(s) 192, 226, 544
NlaIII CATG 6 cut(s) 172, 227, 516, 532, 570, 640
NlaIV GGNNCC 1 cut(s) 629
NspI RCATGY 1 cut(s) 516
PagI TCATGA 1 cut(s) 223
PctI GAATGC 1 cut(s) 163
PfeI GAWTC 1 cut(s) 640
PleI GAGTC 4 cut(s) 130, 166, 479, 602
PpsI GAGTC 4 cut(s) 130, 166, 479, 602
PspN4I GGNNCC 1 cut(s) 629
PspPI GGNCC 2 cut(s) 337, 563
PstI CTGCAG 1 cut(s) 332
RseI CAYNNNNRTG 1 cut(s) 222
Sau3AI GATC 3 cut(s) 192, 226, 544
Sau96I GGNCC 2 cut(s) 337, 563
SchI GAGTC 4 cut(s) 131, 166, 480, 602
SetI ASST 5 cut(s) 186, 247, 373, 467, 589
SfaNI GCATC 1 cut(s) 211
SfcI CTRYAG 1 cut(s) 328
SinI GGWCC 2 cut(s) 337, 563
SmiMI CAYNNNNRTG 1 cut(s) 222
SmlI CTYRAG 1 cut(s) 392
SmoI CTYRAG 1 cut(s) 392
Sse9I AATT 1 cut(s) 93
SsiI CCGC 4 cut(s) 140, 189, 298, 348
StyI CCWWGG 2 cut(s) 33, 566
TaaI ACNGT 1 cut(s) 63
TaiI ACGT 1 cut(s) 467
TaqI TCGA 2 cut(s) 54, 180
TasI AATT 1 cut(s) 93
TfiI GAWTC 1 cut(s) 640
VpaK11BI GGWCC 2 cut(s) 337, 563
XapI RAATTY 1 cut(s) 93
XceI RCATGY 1 cut(s) 516
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.