Rroxscaffold_4G00325760

Belongs to the glycosyl hydrolase 18 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0001259
Physical Location & Seq
Forward (+)
57629306 .. 57640682
11377 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00325760.1

Sequence Viewer

Length: 759 bp
ATGGGAAATTTTTATAAAGAAGAGGATACTTGTCATGTGATTGACAGAGACGACACTAATGTGCTTTTTGGAAGACCATGGCATAAAAGCGTCAAAGGTGGTTATTGCAAAGACAACACATATTTATTTAGGTGGGAGTCGCACAAAATTAAAATCAAGCCTAGAAGGAAGAACATCAAGAATGACCCTCCCGAGGTATGTGAAAAGGAACATGAAGAAGTAACTTTGAAGATTGAAGAGAAACTCATTAAAGACAAGGAATCTGATTCATTCATCACATCGATACCCATGTCATGCATGCCTAATTGTGTTCAAGATCAACCCAAGGAGAAGTCCATGCCCATTCCTTTTCAAGTGGAGGAGTTCAAGTTTCAAGATGCTTATTCTAAACTTGTCTACGGTATTGGATTCATGGTGATACCTTTTAATTTCGAGAATATTGAAGTTGATGGCTTATCATGTTTTATTCCTACTAATGATCGAGCTGCATACAAGAGGAACTCGAGGTCGAGTTCTTATCAAGTGGAGGAGACTGATGTAGGAAAAGATTTTAGCCAATTTCAACCAAAAATCTCGAAAAGAAAGAAGCGTCTTCACATTAAGAAGAATAATTTGAATATTGGAAATTGGTATTCAAATAAGCTTCTTAATGATGGAATTAATCATAAATATATTACTCTTTTGGATATATCGGGATTCTCGAGCAAAATCTTGATTGGGATTCCAAGCGGTTCTACTCGTCGCTTAGAGAAGGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Glyco_hydro_18

Protein Analysis

252

Amino Acids

29.33

Weight (kDa)

8.95

Isoelectric Point (pI)

52.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 15
AccI GTMKAC 1 cut(s) 396
AciI CCGC 1 cut(s) 729
AcsI RAATTY 1 cut(s) 7
AfiI CCNNNNNNNGG 1 cut(s) 193
AleI CACNNNNGTG 1 cut(s) 59
AluBI AGCT 2 cut(s) 485, 643
AluI AGCT 2 cut(s) 485, 643
Alw26I GTCTC 2 cut(s) 42, 524
Ama87I CYCGRG 3 cut(s) 191, 502, 700
ApeKI GCWGC 1 cut(s) 485
ApoI RAATTY 1 cut(s) 7
AseI ATTAAT 1 cut(s) 660
AsuHPI GGTGA 1 cut(s) 427
AvaI CYCGRG 3 cut(s) 191, 502, 700
BaeI ACNNNNGTAYC 2 cut(s) 275, 308
BbsI GAAGAC 2 cut(s) 79, 584
BbvI GCAGC 1 cut(s) 472
BccI CCATC 2 cut(s) 443, 647
BciVI GTATCC 1 cut(s) 19
BcoDI GTCTC 2 cut(s) 42, 524
BfaI CTAG 1 cut(s) 162
BfuI GTATCC 1 cut(s) 19
BisI GCNGC 1 cut(s) 486
BlsI GCNGC 1 cut(s) 487
BmeT110I CYCGRG 3 cut(s) 191, 502, 700
BmsI GCATC 1 cut(s) 367
BpiI GAAGAC 2 cut(s) 79, 584
Bsa29I ATCGAT 1 cut(s) 281
BsaJI CCNNGG 3 cut(s) 77, 192, 324
BsaXI ACNNNNNCTCC 2 cut(s) 353, 383
Bsc4I CCNNNNNNNGG 1 cut(s) 193
BseCI ATCGAT 1 cut(s) 281
BseDI CCNNGG 3 cut(s) 77, 192, 324
BseLI CCNNNNNNNGG 1 cut(s) 193
BseRI GAGGAG 2 cut(s) 374, 542
BseXI GCAGC 1 cut(s) 472
BshVI ATCGAT 1 cut(s) 281
BsiHKCI CYCGRG 3 cut(s) 191, 502, 700
BslI CCNNNNNNNGG 1 cut(s) 193
BsmAI GTCTC 2 cut(s) 42, 524
BsmBI CGTCTC 1 cut(s) 42
BsoBI CYCGRG 3 cut(s) 191, 502, 700
Bsp143I GATC 2 cut(s) 316, 478
Bsp19I CCATGG 1 cut(s) 77
BspACI CCGC 1 cut(s) 729
BspDI ATCGAT 1 cut(s) 281
BssECI CCNNGG 3 cut(s) 77, 192, 324
BssMI GATC 2 cut(s) 316, 478
BssT1I CCWWGG 2 cut(s) 77, 324
Bst4CI ACNGT 1 cut(s) 401
Bst6I CTCTTC 2 cut(s) 15, 231
BstC8I GCNNGC 1 cut(s) 299
BstDEI CTNAG 1 cut(s) 745
BstDSI CCRYGG 1 cut(s) 77
BstKTI GATC 2 cut(s) 319, 481
BstMAI GTCTC 2 cut(s) 42, 524
BstMBI GATC 2 cut(s) 316, 478
BstNSI RCATGY 1 cut(s) 301
BstV1I GCAGC 1 cut(s) 472
BstV2I GAAGAC 2 cut(s) 79, 584
Bsu15I ATCGAT 1 cut(s) 281
BsuI GTATCC 1 cut(s) 19
BsuTUI ATCGAT 1 cut(s) 281
BtgI CCRYGG 1 cut(s) 77
Cac8I GCNNGC 1 cut(s) 299
ClaI ATCGAT 1 cut(s) 281
CseI GACGC 2 cut(s) 79, 578
CviAII CATG 9 cut(s) 35, 78, 212, 289, 294, 298, 337, 412, 459
CviJI RGCY 5 cut(s) 160, 453, 485, 555, 643
CviKI_1 RGCY 5 cut(s) 160, 453, 485, 555, 643
DdeI CTNAG 1 cut(s) 745
DpnI GATC 2 cut(s) 318, 480
DpnII GATC 2 cut(s) 316, 478
Eam1104I CTCTTC 2 cut(s) 15, 231
EarI CTCTTC 2 cut(s) 15, 231
Eco130I CCWWGG 2 cut(s) 77, 324
Eco88I CYCGRG 3 cut(s) 191, 502, 700
EcoT14I CCWWGG 2 cut(s) 77, 324
EcoT22I ATGCAT 1 cut(s) 299
ErhI CCWWGG 2 cut(s) 77, 324
Esp3I CGTCTC 1 cut(s) 42
FaeI CATG 9 cut(s) 38, 81, 215, 292, 297, 301, 340, 415, 462
FatI CATG 9 cut(s) 34, 77, 211, 288, 293, 297, 336, 411, 458
FblI GTMKAC 1 cut(s) 396
Fnu4HI GCNGC 1 cut(s) 486
Fsp4HI GCNGC 1 cut(s) 486
FspBI CTAG 1 cut(s) 162
GluI GCNGC 1 cut(s) 486
HgaI GACGC 2 cut(s) 79, 578
Hin1II CATG 9 cut(s) 38, 81, 215, 292, 297, 301, 340, 415, 462
HindIII AAGCTT 1 cut(s) 641
HinfI GANTC 6 cut(s) 137, 260, 266, 408, 696, 721
HphI GGTGA 1 cut(s) 427
Hpy166II GTNNAC 1 cut(s) 397
Hpy188I TCNGA 1 cut(s) 265
Hpy188III TCNNGA 9 cut(s) 178, 191, 314, 374, 433, 574, 693, 700, 712
Hpy8I GTNNAC 1 cut(s) 397
Hpy99I CGWCG 1 cut(s) 744
HpyAV CCTTC 2 cut(s) 159, 745
HpyCH4III ACNGT 1 cut(s) 401
HpyCH4V TGCA 3 cut(s) 108, 297, 488
HpyF3I CTNAG 1 cut(s) 745
Hsp92II CATG 9 cut(s) 38, 81, 215, 292, 297, 301, 340, 415, 462
Kzo9I GATC 2 cut(s) 316, 478
Lsp1109I GCAGC 1 cut(s) 472
LweI GCATC 1 cut(s) 367
MaeI CTAG 1 cut(s) 162
MaeIII GTNAC 1 cut(s) 220
MalI GATC 2 cut(s) 318, 480
MboI GATC 2 cut(s) 316, 478
MboII GAAGA 8 cut(s) 32, 84, 181, 227, 241, 248, 584, 616
MluCI AATT 8 cut(s) 7, 147, 304, 427, 557, 610, 625, 657
MlyI GAGTC 1 cut(s) 146
MnlI CCTC 7 cut(s) 16, 187, 198, 352, 489, 498, 520
Mph1103I ATGCAT 1 cut(s) 299
MseI TTAA 6 cut(s) 150, 249, 426, 600, 648, 660
MslI CAYNNNNRTG 1 cut(s) 59
NcoI CCATGG 1 cut(s) 77
NdeII GATC 2 cut(s) 316, 478
NlaIII CATG 9 cut(s) 38, 81, 215, 292, 297, 301, 340, 415, 462
NsiI ATGCAT 1 cut(s) 299
NspI RCATGY 1 cut(s) 301
OliI CACNNNNGTG 1 cut(s) 59
PaeI GCATGC 1 cut(s) 301
PaeR7I CTCGAG 2 cut(s) 502, 700
PcsI WCGNNNNNNNCGW 1 cut(s) 698
PfeI GAWTC 5 cut(s) 260, 266, 408, 696, 721
PkrI GCNGC 1 cut(s) 487
PleI GAGTC 1 cut(s) 145
PpsI GAGTC 1 cut(s) 145
PshBI ATTAAT 1 cut(s) 660
PsiI TTATAA 1 cut(s) 15
PspXI VCTCGAGB 1 cut(s) 502
RseI CAYNNNNRTG 1 cut(s) 59
SaqAI TTAA 6 cut(s) 150, 249, 426, 600, 648, 660
SatI GCNGC 1 cut(s) 486
Sau3AI GATC 2 cut(s) 316, 478
SchI GAGTC 1 cut(s) 146
SetI ASST 7 cut(s) 100, 134, 198, 424, 487, 509, 645
SfaNI GCATC 1 cut(s) 367
Sfr274I CTCGAG 2 cut(s) 502, 700
SlaI CTCGAG 2 cut(s) 502, 700
SmiMI CAYNNNNRTG 1 cut(s) 59
SmlI CTYRAG 2 cut(s) 502, 700
SmoI CTYRAG 2 cut(s) 502, 700
SphI GCATGC 1 cut(s) 301
Sse9I AATT 8 cut(s) 7, 147, 304, 427, 557, 610, 625, 657
SsiI CCGC 1 cut(s) 729
SspI AATATT 2 cut(s) 439, 619
SspMI CTAG 1 cut(s) 162
StyI CCWWGG 2 cut(s) 77, 324
TaaI ACNGT 1 cut(s) 401
TaqI TCGA 7 cut(s) 281, 432, 481, 503, 509, 575, 701
TasI AATT 8 cut(s) 7, 147, 304, 427, 557, 610, 625, 657
TfiI GAWTC 5 cut(s) 260, 266, 408, 696, 721
Tru1I TTAA 6 cut(s) 150, 249, 426, 600, 648, 660
Tru9I TTAA 6 cut(s) 150, 249, 426, 600, 648, 660
TseI GCWGC 1 cut(s) 485
TspDTI ATGAA 4 cut(s) 228, 258, 262, 400
VspI ATTAAT 1 cut(s) 660
XapI RAATTY 1 cut(s) 7
XceI RCATGY 1 cut(s) 301
XhoI CTCGAG 2 cut(s) 502, 700
XmiI GTMKAC 1 cut(s) 396
XspI CTAG 1 cut(s) 162
Zsp2I ATGCAT 1 cut(s) 299
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.