RchiOBHm_Chr2g0137451

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0001259
Physical Location & Seq
Reverse (-)
55235232 .. 55235594
363 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50819

Sequence Viewer

Length: 363 bp
ATGGAAGAAACTCCACAAGAAATCATCCATGATGATCAAGAAGATGTTAAAGATGAAATTGCTCATGAAGACATGGTTATTTGTAATGGTGAAGTCTTGGATCCTGAAATAAATCATTCAGAACCAGATGTCATTCAAGAATGCAACCTTGAGCGCCAAGAAGAATCTACTACGGTTGCCTATGAAAGCCAAAATGCATATGACAGACTCATCTTTGGCGTTGGGTTCATGATTGTGCCATCAAAATTTGCAGAGGATCAGGCCAATAATCCACAGGTTCAATTGTCTAATTTTTCTCGAGTCTTTTGTCTACCTATTCTTGTCTTTTATTCAAGAGGAACTCGAGGGCAAGTTCTTTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

120

Amino Acids

13.69

Weight (kDa)

4.16

Isoelectric Point (pI)

55.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 310
AclWI GGATC 3 cut(s) 95, 108, 264
AcsI RAATTY 1 cut(s) 245
AgsI TTSAA 3 cut(s) 137, 281, 333
AlwI GGATC 3 cut(s) 95, 108, 264
Ama87I CYCGRG 2 cut(s) 297, 342
AoxI GGCC 1 cut(s) 261
ApoI RAATTY 1 cut(s) 245
AspLEI GCGC 1 cut(s) 156
AsuHPI GGTGA 1 cut(s) 101
AvaI CYCGRG 2 cut(s) 297, 342
BamHI GGATCC 1 cut(s) 100
BbsI GAAGAC 1 cut(s) 75
BccI CCATC 1 cut(s) 247
BclI TGATCA 1 cut(s) 34
BfoI RGCGCY 1 cut(s) 157
BmeT110I CYCGRG 2 cut(s) 297, 342
BmiI GGNNCC 1 cut(s) 102
BpiI GAAGAC 1 cut(s) 75
BpuEI CTTGAG 1 cut(s) 170
BseGI GGATG 1 cut(s) 24
BshFI GGCC 1 cut(s) 263
BsiHKCI CYCGRG 2 cut(s) 297, 342
BsmI GAATGC 1 cut(s) 146
BsnI GGCC 1 cut(s) 263
BsoBI CYCGRG 2 cut(s) 297, 342
Bsp143I GATC 3 cut(s) 34, 100, 256
BspANI GGCC 1 cut(s) 263
BspHI TCATGA 2 cut(s) 64, 228
BspLI GGNNCC 1 cut(s) 102
BspPI GGATC 3 cut(s) 95, 108, 264
BssMI GATC 3 cut(s) 34, 100, 256
Bst4CI ACNGT 1 cut(s) 175
BstF5I GGATG 1 cut(s) 24
BstH2I RGCGCY 1 cut(s) 157
BstHHI GCGC 1 cut(s) 156
BstKTI GATC 3 cut(s) 37, 103, 259
BstMBI GATC 3 cut(s) 34, 100, 256
BstV2I GAAGAC 1 cut(s) 75
BstX2I RGATCY 1 cut(s) 100
BstYI RGATCY 1 cut(s) 100
BsuRI GGCC 1 cut(s) 263
BtsCI GGATG 1 cut(s) 24
CciI TCATGA 2 cut(s) 64, 228
CfoI GCGC 1 cut(s) 156
CviAII CATG 4 cut(s) 29, 65, 73, 229
CviJI RGCY 2 cut(s) 189, 263
CviKI_1 RGCY 2 cut(s) 189, 263
DpnI GATC 3 cut(s) 36, 102, 258
DpnII GATC 3 cut(s) 34, 100, 256
Eco88I CYCGRG 2 cut(s) 297, 342
EcoT22I ATGCAT 1 cut(s) 199
FaeI CATG 4 cut(s) 32, 68, 76, 232
FaiI YATR 8 cut(s) 30, 66, 74, 183, 199, 201, 230, 361
FatI CATG 4 cut(s) 28, 64, 72, 228
FauNDI CATATG 1 cut(s) 199
FbaI TGATCA 1 cut(s) 34
FblI GTMKAC 1 cut(s) 310
FokI GGATG 1 cut(s) 11
GlaI GCGC 1 cut(s) 155
HaeII RGCGCY 1 cut(s) 157
HaeIII GGCC 1 cut(s) 263
HhaI GCGC 1 cut(s) 156
Hin1II CATG 4 cut(s) 32, 68, 76, 232
Hin6I GCGC 1 cut(s) 154
HinP1I GCGC 1 cut(s) 154
HinfI GANTC 3 cut(s) 164, 207, 300
HphI GGTGA 1 cut(s) 101
Hpy166II GTNNAC 1 cut(s) 311
Hpy188I TCNGA 1 cut(s) 121
Hpy188III TCNNGA 7 cut(s) 38, 65, 104, 137, 229, 297, 333
Hpy8I GTNNAC 1 cut(s) 311
HpyCH4III ACNGT 1 cut(s) 175
HpyCH4V TGCA 3 cut(s) 144, 197, 251
Hsp92II CATG 4 cut(s) 32, 68, 76, 232
HspAI GCGC 1 cut(s) 154
Ksp22I TGATCA 1 cut(s) 34
Kzo9I GATC 3 cut(s) 34, 100, 256
LpnPI CCDG 4 cut(s) 117, 138, 245, 260
MalI GATC 3 cut(s) 36, 102, 258
MboI GATC 3 cut(s) 34, 100, 256
MboII GAAGA 4 cut(s) 17, 53, 80, 173
MfeI CAATTG 1 cut(s) 281
MflI RGATCY 1 cut(s) 100
MluCI AATT 4 cut(s) 57, 245, 281, 289
MlyI GAGTC 2 cut(s) 201, 309
MnlI CCTC 3 cut(s) 247, 329, 338
Mph1103I ATGCAT 1 cut(s) 199
MseI TTAA 1 cut(s) 48
MslI CAYNNNNRTG 1 cut(s) 233
MunI CAATTG 1 cut(s) 281
Mva1269I GAATGC 1 cut(s) 146
NdeI CATATG 1 cut(s) 199
NdeII GATC 3 cut(s) 34, 100, 256
NlaIII CATG 4 cut(s) 32, 68, 76, 232
NlaIV GGNNCC 1 cut(s) 102
NsiI ATGCAT 1 cut(s) 199
PaeR7I CTCGAG 2 cut(s) 297, 342
PagI TCATGA 2 cut(s) 64, 228
PctI GAATGC 1 cut(s) 146
PfeI GAWTC 1 cut(s) 164
PleI GAGTC 2 cut(s) 201, 308
PpsI GAGTC 2 cut(s) 201, 308
PspN4I GGNNCC 1 cut(s) 102
PspXI VCTCGAGB 1 cut(s) 342
PsuI RGATCY 1 cut(s) 100
RseI CAYNNNNRTG 1 cut(s) 233
SaqAI TTAA 1 cut(s) 48
Sau3AI GATC 3 cut(s) 34, 100, 256
SchI GAGTC 2 cut(s) 201, 309
SetI ASST 3 cut(s) 150, 279, 316
Sfr274I CTCGAG 2 cut(s) 297, 342
SlaI CTCGAG 2 cut(s) 297, 342
SmiMI CAYNNNNRTG 1 cut(s) 233
SmlI CTYRAG 3 cut(s) 149, 297, 342
SmoI CTYRAG 3 cut(s) 149, 297, 342
Sse9I AATT 4 cut(s) 57, 245, 281, 289
TaaI ACNGT 1 cut(s) 175
TaqI TCGA 2 cut(s) 298, 343
TasI AATT 4 cut(s) 57, 245, 281, 289
TfiI GAWTC 1 cut(s) 164
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
TspDTI ATGAA 5 cut(s) 69, 81, 198, 217, 348
XapI RAATTY 1 cut(s) 245
XhoI CTCGAG 2 cut(s) 297, 342
XmiI GTMKAC 1 cut(s) 310
Zsp2I ATGCAT 1 cut(s) 199
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.