Rmu_sc0003383.1_g000016

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003383.1
Physical Location & Seq
Reverse (-)
60484 .. 60822
339 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003383.1_g000016.1.cds

Sequence Viewer

Length: 339 bp
atgaaagcatcaaaggtggttattgcaaaggcaacacatttatttaggtgggagttgcacaaaattaaaatcaagcctggaaggaagaacatcaagaatgaccatcctgaggtgtgtgaaaaggaacatgaagaagccactttgaagatcgaagagaaactcattaaggacaaggaagctgattcattcatcacatcaatatccatgtcatgcatgcctaattgtgttcaagatcaatccaaggagaagtcaatgcccattcattttcaagtggaggagttcaagtttcaagatgcttgttctagtctacggtattggatacatggtgataccttttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

13.12

Weight (kDa)

7.71

Isoelectric Point (pI)

54.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 307
AfiI CCNNNNNNNGG 1 cut(s) 109
AgsI TTSAA 5 cut(s) 145, 230, 269, 283, 290
AjnI CCWGG 1 cut(s) 76
AluBI AGCT 1 cut(s) 179
AluI AGCT 1 cut(s) 179
AsuHPI GGTGA 1 cut(s) 338
AxyI CCTNAGG 1 cut(s) 108
BccI CCATC 1 cut(s) 111
BciT130I CCWGG 1 cut(s) 78
BciVI GTATCC 1 cut(s) 312
BfaI CTAG 1 cut(s) 303
BfuI GTATCC 1 cut(s) 312
Bme1390I CCNGG 1 cut(s) 78
BmrFI CCNGG 1 cut(s) 78
BmsI GCATC 2 cut(s) 17, 283
BsaJI CCNNGG 1 cut(s) 240
BsaXI ACNNNNNCTCC 2 cut(s) 269, 299
Bsc4I CCNNNNNNNGG 1 cut(s) 109
Bse21I CCTNAGG 1 cut(s) 108
BseBI CCWGG 1 cut(s) 78
BseDI CCNNGG 1 cut(s) 240
BseGI GGATG 1 cut(s) 103
BseLI CCNNNNNNNGG 1 cut(s) 109
BseMII CTCAG 1 cut(s) 99
BseRI GAGGAG 1 cut(s) 290
BslI CCNNNNNNNGG 1 cut(s) 109
Bsp143I GATC 2 cut(s) 147, 232
BspCNI CTCAG 1 cut(s) 100
BssECI CCNNGG 1 cut(s) 240
BssMI GATC 2 cut(s) 147, 232
BssT1I CCWWGG 1 cut(s) 240
Bst2UI CCWGG 1 cut(s) 78
Bst4CI ACNGT 1 cut(s) 312
Bst6I CTCTTC 1 cut(s) 147
BstC8I GCNNGC 1 cut(s) 215
BstDEI CTNAG 1 cut(s) 108
BstF5I GGATG 1 cut(s) 103
BstKTI GATC 2 cut(s) 150, 235
BstMBI GATC 2 cut(s) 147, 232
BstNI CCWGG 1 cut(s) 78
BstNSI RCATGY 1 cut(s) 217
BstSCI CCNGG 1 cut(s) 76
Bsu36I CCTNAGG 1 cut(s) 108
BsuI GTATCC 1 cut(s) 312
BtsCI GGATG 1 cut(s) 103
Cac8I GCNNGC 1 cut(s) 215
CviAII CATG 5 cut(s) 128, 205, 210, 214, 323
CviJI RGCY 3 cut(s) 76, 137, 179
CviKI_1 RGCY 3 cut(s) 76, 137, 179
DdeI CTNAG 1 cut(s) 108
DpnI GATC 2 cut(s) 149, 234
DpnII GATC 2 cut(s) 147, 232
Eam1104I CTCTTC 1 cut(s) 147
EarI CTCTTC 1 cut(s) 147
Eco130I CCWWGG 1 cut(s) 240
Eco81I CCTNAGG 1 cut(s) 108
EcoRII CCWGG 1 cut(s) 76
EcoT14I CCWWGG 1 cut(s) 240
EcoT22I ATGCAT 1 cut(s) 215
ErhI CCWWGG 1 cut(s) 240
FaeI CATG 5 cut(s) 131, 208, 213, 217, 326
FaiI YATR 5 cut(s) 129, 206, 211, 215, 324
FatI CATG 5 cut(s) 127, 204, 209, 213, 322
FblI GTMKAC 1 cut(s) 307
FokI GGATG 1 cut(s) 90
FspBI CTAG 1 cut(s) 303
Hin1II CATG 5 cut(s) 131, 208, 213, 217, 326
HinfI GANTC 1 cut(s) 182
HphI GGTGA 1 cut(s) 338
Hpy166II GTNNAC 1 cut(s) 308
Hpy188III TCNNGA 4 cut(s) 94, 107, 230, 290
Hpy8I GTNNAC 1 cut(s) 308
HpyAV CCTTC 1 cut(s) 75
HpyCH4III ACNGT 1 cut(s) 312
HpyCH4V TGCA 3 cut(s) 26, 58, 213
HpyF3I CTNAG 1 cut(s) 108
Hsp92II CATG 5 cut(s) 131, 208, 213, 217, 326
Kzo9I GATC 2 cut(s) 147, 232
LpnPI CCDG 3 cut(s) 63, 90, 120
LweI GCATC 2 cut(s) 17, 283
MaeI CTAG 1 cut(s) 303
MalI GATC 2 cut(s) 149, 234
MboI GATC 2 cut(s) 147, 232
MboII GAAGA 4 cut(s) 97, 143, 157, 164
MluCI AATT 2 cut(s) 63, 220
MnlI CCTC 2 cut(s) 103, 268
Mph1103I ATGCAT 1 cut(s) 215
MseI TTAA 3 cut(s) 66, 165, 337
MspR9I CCNGG 1 cut(s) 78
MvaI CCWGG 1 cut(s) 78
NdeII GATC 2 cut(s) 147, 232
NlaIII CATG 5 cut(s) 131, 208, 213, 217, 326
NsiI ATGCAT 1 cut(s) 215
NspI RCATGY 1 cut(s) 217
PaeI GCATGC 1 cut(s) 217
PfeI GAWTC 1 cut(s) 182
Psp6I CCWGG 1 cut(s) 76
PspGI CCWGG 1 cut(s) 76
SaqAI TTAA 3 cut(s) 66, 165, 337
Sau3AI GATC 2 cut(s) 147, 232
ScrFI CCNGG 1 cut(s) 78
SetI ASST 5 cut(s) 18, 50, 114, 181, 335
SfaNI GCATC 2 cut(s) 17, 283
SphI GCATGC 1 cut(s) 217
Sse9I AATT 2 cut(s) 63, 220
SspMI CTAG 1 cut(s) 303
StyD4I CCNGG 1 cut(s) 76
StyI CCWWGG 1 cut(s) 240
TaaI ACNGT 1 cut(s) 312
TaqI TCGA 1 cut(s) 150
TasI AATT 2 cut(s) 63, 220
TfiI GAWTC 1 cut(s) 182
Tru1I TTAA 3 cut(s) 66, 165, 337
Tru9I TTAA 3 cut(s) 66, 165, 337
TspDTI ATGAA 5 cut(s) 17, 144, 174, 178, 251
XceI RCATGY 1 cut(s) 217
XmiI GTMKAC 1 cut(s) 307
XspI CTAG 1 cut(s) 303
Zsp2I ATGCAT 1 cut(s) 215
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.