Rh4DG115600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0001259
Physical Location & Seq
Forward (+)
18239789 .. 18244881
5093 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG115600.1

Sequence Viewer

Length: 297 bp
ATGAAGCTTGGAAGGAAGAACCTCAAGAATGACCATCCTGAGGTGTGTGAAAAGGAACATGAAGAAGCCAGTTTGAAGATTGAGGAGAAACTCATTAAGGACAAGGAAGCTGATTCATTCATCACATTGATATCCATGTCATGCATGCCTAATTGTATTCAAGATCAACCCAAGGAAAAGTCAATGCCCATTCCTTTTCAAGTGGAGGAGTTCAAGTTTCAAGATGATTATGCTAAACTTGTCTACGCCTTCTTACTAGGCTCCCTCTTGTTGCTTACTTTTCGAGGGCAATCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

98

Amino Acids

11.37

Weight (kDa)

5.38

Isoelectric Point (pI)

53.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 243
AfiI CCNNNNNNNGG 1 cut(s) 40
AgsI TTSAA 5 cut(s) 76, 161, 200, 214, 221
AluBI AGCT 2 cut(s) 7, 110
AluI AGCT 2 cut(s) 7, 110
AxyI CCTNAGG 1 cut(s) 39
BccI CCATC 1 cut(s) 42
BfaI CTAG 1 cut(s) 257
BmiI GGNNCC 1 cut(s) 262
BpuEI CTTGAG 1 cut(s) 8
BsaJI CCNNGG 1 cut(s) 171
BsaXI ACNNNNNCTCC 2 cut(s) 200, 230
Bsc4I CCNNNNNNNGG 1 cut(s) 40
Bse1I ACTGG 1 cut(s) 69
Bse21I CCTNAGG 1 cut(s) 39
BseDI CCNNGG 1 cut(s) 171
BseGI GGATG 1 cut(s) 34
BseLI CCNNNNNNNGG 1 cut(s) 40
BseMII CTCAG 1 cut(s) 30
BseNI ACTGG 1 cut(s) 69
BseRI GAGGAG 2 cut(s) 98, 221
BslI CCNNNNNNNGG 1 cut(s) 40
Bsp143I GATC 1 cut(s) 163
BspCNI CTCAG 1 cut(s) 31
BspLI GGNNCC 1 cut(s) 262
BsrI ACTGG 1 cut(s) 69
BssECI CCNNGG 1 cut(s) 171
BssMI GATC 1 cut(s) 163
BssT1I CCWWGG 1 cut(s) 171
BstC8I GCNNGC 1 cut(s) 146
BstDEI CTNAG 1 cut(s) 39
BstF5I GGATG 1 cut(s) 34
BstKTI GATC 1 cut(s) 166
BstMBI GATC 1 cut(s) 163
BstNSI RCATGY 1 cut(s) 148
Bsu36I CCTNAGG 1 cut(s) 39
BtsCI GGATG 1 cut(s) 34
Cac8I GCNNGC 1 cut(s) 146
CviAII CATG 4 cut(s) 59, 136, 141, 145
CviJI RGCY 4 cut(s) 7, 68, 110, 261
CviKI_1 RGCY 4 cut(s) 7, 68, 110, 261
DdeI CTNAG 1 cut(s) 39
DpnI GATC 1 cut(s) 165
DpnII GATC 1 cut(s) 163
Eco130I CCWWGG 1 cut(s) 171
Eco32I GATATC 1 cut(s) 132
Eco81I CCTNAGG 1 cut(s) 39
EcoRV GATATC 1 cut(s) 132
EcoT14I CCWWGG 1 cut(s) 171
EcoT22I ATGCAT 1 cut(s) 146
ErhI CCWWGG 1 cut(s) 171
FaeI CATG 4 cut(s) 62, 139, 144, 148
FaiI YATR 5 cut(s) 60, 137, 142, 146, 231
FatI CATG 4 cut(s) 58, 135, 140, 144
FblI GTMKAC 1 cut(s) 243
FokI GGATG 1 cut(s) 21
FspBI CTAG 1 cut(s) 257
Hin1II CATG 4 cut(s) 62, 139, 144, 148
HindIII AAGCTT 1 cut(s) 5
HinfI GANTC 1 cut(s) 113
Hpy166II GTNNAC 1 cut(s) 244
Hpy188III TCNNGA 5 cut(s) 25, 38, 161, 221, 294
Hpy8I GTNNAC 1 cut(s) 244
HpyAV CCTTC 2 cut(s) 6, 259
HpyCH4V TGCA 1 cut(s) 144
HpyF3I CTNAG 1 cut(s) 39
Hsp92II CATG 4 cut(s) 62, 139, 144, 148
Kzo9I GATC 1 cut(s) 163
LmnI GCTCC 1 cut(s) 266
LpnPI CCDG 2 cut(s) 51, 82
MaeI CTAG 1 cut(s) 257
MalI GATC 1 cut(s) 165
MboI GATC 1 cut(s) 163
MboII GAAGA 3 cut(s) 28, 74, 88
MluCI AATT 1 cut(s) 151
MnlI CCTC 6 cut(s) 32, 34, 76, 199, 275, 278
Mph1103I ATGCAT 1 cut(s) 146
MseI TTAA 1 cut(s) 96
NdeII GATC 1 cut(s) 163
NlaIII CATG 4 cut(s) 62, 139, 144, 148
NlaIV GGNNCC 1 cut(s) 262
NsiI ATGCAT 1 cut(s) 146
NspI RCATGY 1 cut(s) 148
PaeI GCATGC 1 cut(s) 148
PfeI GAWTC 1 cut(s) 113
PspN4I GGNNCC 1 cut(s) 262
SaqAI TTAA 1 cut(s) 96
Sau3AI GATC 1 cut(s) 163
SetI ASST 4 cut(s) 9, 24, 45, 112
SmlI CTYRAG 1 cut(s) 23
SmoI CTYRAG 1 cut(s) 23
SphI GCATGC 1 cut(s) 148
Sse9I AATT 1 cut(s) 151
SspMI CTAG 1 cut(s) 257
StyI CCWWGG 1 cut(s) 171
TaqI TCGA 1 cut(s) 283
TasI AATT 1 cut(s) 151
TfiI GAWTC 1 cut(s) 113
Tru1I TTAA 1 cut(s) 96
Tru9I TTAA 1 cut(s) 96
TspDTI ATGAA 4 cut(s) 17, 75, 105, 109
XceI RCATGY 1 cut(s) 148
XmiI GTMKAC 1 cut(s) 243
XspI CTAG 1 cut(s) 257
Zsp2I ATGCAT 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.