RchiOBHm_Chr5g0023581

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
17612181 .. 17614483
2303 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30344

Sequence Viewer

Length: 234 bp
ATGAGATTACTAGCCGCTGGAATATTCAAGAAGATTTGGTTTTGGACTTTTCGGGTTACTCGTATAAAAAGACAAGCGGCGGGAGAGCTTGGTGGGGAGGAGGACGGCATCGGTGGGGAAGTCGATGTAGTGAGGGAGGAAGATGACGTCATCATAGGTGTAGGAGTAGCCCTGGTTGACGTCATCGTGCTGATGTCAACCCCGCTGCCCTACTCAGCTCGCTCTCGACACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

77

Amino Acids

8.51

Weight (kDa)

5.73

Isoelectric Point (pI)

34.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 2 cut(s) 150, 183
AciI CCGC 4 cut(s) 15, 77, 80, 203
AcyI GRCGYC 2 cut(s) 147, 180
AgsI TTSAA 1 cut(s) 28
AjnI CCWGG 1 cut(s) 171
AluBI AGCT 2 cut(s) 88, 218
AluI AGCT 2 cut(s) 88, 218
ApeKI GCWGC 1 cut(s) 205
BbvI GCAGC 1 cut(s) 192
BceAI ACGGC 1 cut(s) 121
BciT130I CCWGG 1 cut(s) 173
BfaI CTAG 1 cut(s) 11
BisI GCNGC 3 cut(s) 15, 78, 206
BlsI GCNGC 3 cut(s) 16, 79, 207
Bme1390I CCNGG 1 cut(s) 173
BmrFI CCNGG 1 cut(s) 173
BmsI GCATC 1 cut(s) 117
BsaHI GRCGYC 2 cut(s) 147, 180
BsaJI CCNNGG 1 cut(s) 171
BseBI CCWGG 1 cut(s) 173
BseDI CCNNGG 1 cut(s) 171
BseMII CTCAG 1 cut(s) 228
BseRI GAGGAG 1 cut(s) 113
BseXI GCAGC 1 cut(s) 192
BspACI CCGC 4 cut(s) 15, 77, 80, 203
BspCNI CTCAG 1 cut(s) 227
BssECI CCNNGG 1 cut(s) 171
BssNI GRCGYC 2 cut(s) 147, 180
Bst2UI CCWGG 1 cut(s) 173
BstACI GRCGYC 2 cut(s) 147, 180
BstC8I GCNNGC 1 cut(s) 220
BstDEI CTNAG 1 cut(s) 214
BstNI CCWGG 1 cut(s) 173
BstSCI CCNGG 1 cut(s) 171
BstV1I GCAGC 1 cut(s) 192
BtsIMutI CAGTG 1 cut(s) 229
Cac8I GCNNGC 1 cut(s) 220
CviJI RGCY 4 cut(s) 14, 88, 170, 218
CviKI_1 RGCY 4 cut(s) 14, 88, 170, 218
DdeI CTNAG 1 cut(s) 214
EcoRII CCWGG 1 cut(s) 171
FaiI YATR 2 cut(s) 65, 155
FauI CCCGC 2 cut(s) 73, 210
Fnu4HI GCNGC 3 cut(s) 15, 78, 206
Fsp4HI GCNGC 3 cut(s) 15, 78, 206
FspBI CTAG 1 cut(s) 11
GluI GCNGC 3 cut(s) 15, 78, 206
Hin1I GRCGYC 2 cut(s) 147, 180
HincII GTYRAC 2 cut(s) 178, 198
HindII GTYRAC 2 cut(s) 178, 198
Hpy166II GTNNAC 2 cut(s) 178, 198
Hpy188III TCNNGA 2 cut(s) 28, 225
Hpy8I GTNNAC 2 cut(s) 178, 198
HpyCH4IV ACGT 2 cut(s) 147, 180
HpyF3I CTNAG 1 cut(s) 214
HpySE526I ACGT 2 cut(s) 147, 180
Hsp92I GRCGYC 2 cut(s) 147, 180
LpnPI CCDG 3 cut(s) 3, 158, 185
Lsp1109I GCAGC 1 cut(s) 192
LweI GCATC 1 cut(s) 117
MaeI CTAG 1 cut(s) 11
MaeII ACGT 2 cut(s) 147, 180
MaeIII GTNAC 1 cut(s) 55
MboII GAAGA 2 cut(s) 43, 152
MnlI CCTC 4 cut(s) 91, 94, 126, 130
MspA1I CMGCKG 2 cut(s) 17, 205
MspR9I CCNGG 1 cut(s) 173
MvaI CCWGG 1 cut(s) 173
PcsI WCGNNNNNNNCGW 1 cut(s) 58
PkrI GCNGC 3 cut(s) 16, 79, 207
Psp6I CCWGG 1 cut(s) 171
PspGI CCWGG 1 cut(s) 171
SatI GCNGC 3 cut(s) 15, 78, 206
ScrFI CCNGG 1 cut(s) 173
SetI ASST 5 cut(s) 90, 150, 160, 183, 220
SfaNI GCATC 1 cut(s) 117
SsiI CCGC 4 cut(s) 15, 77, 80, 203
SspI AATATT 1 cut(s) 24
SspMI CTAG 1 cut(s) 11
StyD4I CCNGG 1 cut(s) 171
TaiI ACGT 2 cut(s) 150, 183
TaqI TCGA 2 cut(s) 123, 226
TauI GCSGC 2 cut(s) 17, 80
TseI GCWGC 1 cut(s) 205
XspI CTAG 1 cut(s) 11
ZraI GACGTC 2 cut(s) 148, 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.