Rh7DG052000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0001259
Physical Location & Seq
Reverse (-)
3978919 .. 3980261
1343 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG052000.1

Sequence Viewer

Length: 159 bp
ATGCCTAATTGTGTTCAAGATCAACCCAAGGAGAAGTCATTGCCCATTCCTTTTCAAGTGGAGGAGTTCAAGTTTCAAGATGCTTATTCTAAACTTGTCTACGGTATTGGATTCATGGTTGAAAAACCCCTTCTGGGCCCAAGGGGATTGACTGATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

5.93

Weight (kDa)

5.18

Isoelectric Point (pI)

25.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 99
AfiI CCNNNNNNNGG 1 cut(s) 134
AgsI TTSAA 5 cut(s) 17, 56, 70, 77, 122
AoxI GGCC 1 cut(s) 136
ApaI GGGCCC 1 cut(s) 140
AspS9I GGNCC 2 cut(s) 136, 137
BaeGI GKGCMC 1 cut(s) 140
BanII GRGCYC 1 cut(s) 140
BmgT120I GGNCC 2 cut(s) 136, 137
BmiI GGNNCC 1 cut(s) 138
BmsI GCATC 1 cut(s) 70
BsaJI CCNNGG 2 cut(s) 27, 140
BsaXI ACNNNNNCTCC 2 cut(s) 56, 86
Bsc4I CCNNNNNNNGG 1 cut(s) 134
Bse3DI GCAATG 1 cut(s) 38
BseDI CCNNGG 2 cut(s) 27, 140
BseLI CCNNNNNNNGG 1 cut(s) 134
BseMI GCAATG 1 cut(s) 38
BseRI GAGGAG 1 cut(s) 77
BseSI GKGCMC 1 cut(s) 140
BshFI GGCC 1 cut(s) 138
BslI CCNNNNNNNGG 1 cut(s) 134
BsnI GGCC 1 cut(s) 138
Bsp120I GGGCCC 1 cut(s) 136
Bsp1286I GDGCHC 1 cut(s) 140
Bsp143I GATC 1 cut(s) 19
BspANI GGCC 1 cut(s) 138
BspLI GGNNCC 1 cut(s) 138
BsrDI GCAATG 1 cut(s) 38
BssECI CCNNGG 2 cut(s) 27, 140
BssMI GATC 1 cut(s) 19
BssT1I CCWWGG 2 cut(s) 27, 140
Bst4CI ACNGT 1 cut(s) 104
BstKTI GATC 1 cut(s) 22
BstMBI GATC 1 cut(s) 19
BstSLI GKGCMC 1 cut(s) 140
BsuRI GGCC 1 cut(s) 138
Cfr13I GGNCC 2 cut(s) 136, 137
CviAII CATG 1 cut(s) 115
CviJI RGCY 1 cut(s) 138
CviKI_1 RGCY 1 cut(s) 138
DpnI GATC 1 cut(s) 21
DpnII GATC 1 cut(s) 19
Eco130I CCWWGG 2 cut(s) 27, 140
Eco24I GRGCYC 1 cut(s) 140
EcoT14I CCWWGG 2 cut(s) 27, 140
EcoT38I GRGCYC 1 cut(s) 140
ErhI CCWWGG 2 cut(s) 27, 140
FaeI CATG 1 cut(s) 118
FaiI YATR 1 cut(s) 116
FatI CATG 1 cut(s) 114
FblI GTMKAC 1 cut(s) 99
FriOI GRGCYC 1 cut(s) 140
HaeIII GGCC 1 cut(s) 138
Hin1II CATG 1 cut(s) 118
HinfI GANTC 1 cut(s) 111
Hpy166II GTNNAC 1 cut(s) 100
Hpy188III TCNNGA 2 cut(s) 17, 77
Hpy8I GTNNAC 1 cut(s) 100
HpyAV CCTTC 1 cut(s) 140
HpyCH4III ACNGT 1 cut(s) 104
Hsp92II CATG 1 cut(s) 118
Kzo9I GATC 1 cut(s) 19
LpnPI CCDG 1 cut(s) 119
LweI GCATC 1 cut(s) 70
MalI GATC 1 cut(s) 21
MboI GATC 1 cut(s) 19
MhlI GDGCHC 1 cut(s) 140
MluCI AATT 1 cut(s) 7
MnlI CCTC 1 cut(s) 55
NdeII GATC 1 cut(s) 19
NlaIII CATG 1 cut(s) 118
NlaIV GGNNCC 1 cut(s) 138
PfeI GAWTC 1 cut(s) 111
PspN4I GGNNCC 1 cut(s) 138
PspOMI GGGCCC 1 cut(s) 136
PspPI GGNCC 2 cut(s) 136, 137
Sau3AI GATC 1 cut(s) 19
Sau96I GGNCC 2 cut(s) 136, 137
SduI GDGCHC 1 cut(s) 140
SfaNI GCATC 1 cut(s) 70
SgeI CNNG 9 cut(s) 29, 40, 68, 82, 89, 107, 127, 146, 153
Sse9I AATT 1 cut(s) 7
StyI CCWWGG 2 cut(s) 27, 140
TaaI ACNGT 1 cut(s) 104
TasI AATT 1 cut(s) 7
TfiI GAWTC 1 cut(s) 111
TspDTI ATGAA 1 cut(s) 103
XmiI GTMKAC 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.