Rh1DG013300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
OG0001259
Physical Location & Seq
Forward (+)
2161039 .. 2166642
5604 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG013300.1

Sequence Viewer

Length: 294 bp
ATGAACACCAAGAATGACCATCCTGAGGTGTGTGAAAAGGAACATGAAGAAGCCACTTTGAAGATTGAAGAGAAACTCATTAAGGACACGAAAGCTGATTCATTTATCACACCGATATCCATGTCATGCATGCCTAATTGTGTTCAAGATCAACCCAAGGAGAAGTCAATGTCCATTCCTTTTCAAGTGGAGGAGTTCAAGTTTCAAGATGCTTATTCTAAACTTGTCTACGAAAGCAAAGTGGGAGAGACGGATAGGTTGAGCAAGAAATGGCTCCTGGCCGAAGTTTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

97

Amino Acids

11.23

Weight (kDa)

5.04

Isoelectric Point (pI)

42.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 228
AcoI YGGCCR 1 cut(s) 279
AfiI CCNNNNNNNGG 1 cut(s) 25
AgsI TTSAA 6 cut(s) 61, 68, 146, 185, 199, 206
AjnI CCWGG 1 cut(s) 276
AluBI AGCT 1 cut(s) 95
AluI AGCT 1 cut(s) 95
Alw26I GTCTC 1 cut(s) 242
AoxI GGCC 1 cut(s) 279
AxyI CCTNAGG 1 cut(s) 24
BccI CCATC 1 cut(s) 27
BciT130I CCWGG 1 cut(s) 278
BcoDI GTCTC 1 cut(s) 242
Bme1390I CCNGG 1 cut(s) 278
BmiI GGNNCC 1 cut(s) 275
BmrFI CCNGG 1 cut(s) 278
BmsI GCATC 1 cut(s) 199
BsaJI CCNNGG 1 cut(s) 156
BsaXI ACNNNNNCTCC 2 cut(s) 185, 215
Bsc4I CCNNNNNNNGG 1 cut(s) 25
Bse21I CCTNAGG 1 cut(s) 24
BseBI CCWGG 1 cut(s) 278
BseDI CCNNGG 1 cut(s) 156
BseGI GGATG 1 cut(s) 19
BseLI CCNNNNNNNGG 1 cut(s) 25
BseMII CTCAG 1 cut(s) 15
BseRI GAGGAG 1 cut(s) 206
BshFI GGCC 1 cut(s) 281
BslI CCNNNNNNNGG 1 cut(s) 25
BsmAI GTCTC 1 cut(s) 242
BsmBI CGTCTC 1 cut(s) 242
BsnI GGCC 1 cut(s) 281
Bsp143I GATC 1 cut(s) 148
BspANI GGCC 1 cut(s) 281
BspCNI CTCAG 1 cut(s) 16
BspHI TCATGA 1 cut(s) 290
BspLI GGNNCC 1 cut(s) 275
BssECI CCNNGG 1 cut(s) 156
BssMI GATC 1 cut(s) 148
BssT1I CCWWGG 1 cut(s) 156
Bst2UI CCWGG 1 cut(s) 278
Bst6I CTCTTC 1 cut(s) 63
BstC8I GCNNGC 1 cut(s) 131
BstDEI CTNAG 1 cut(s) 24
BstF5I GGATG 1 cut(s) 19
BstKTI GATC 1 cut(s) 151
BstMAI GTCTC 1 cut(s) 242
BstMBI GATC 1 cut(s) 148
BstNI CCWGG 1 cut(s) 278
BstNSI RCATGY 1 cut(s) 133
BstSCI CCNGG 1 cut(s) 276
Bsu36I CCTNAGG 1 cut(s) 24
BsuRI GGCC 1 cut(s) 281
BtsCI GGATG 1 cut(s) 19
Cac8I GCNNGC 1 cut(s) 131
CciI TCATGA 1 cut(s) 290
CviAII CATG 5 cut(s) 44, 121, 126, 130, 291
CviJI RGCY 4 cut(s) 53, 95, 274, 281
CviKI_1 RGCY 4 cut(s) 53, 95, 274, 281
DdeI CTNAG 1 cut(s) 24
DpnI GATC 1 cut(s) 150
DpnII GATC 1 cut(s) 148
EaeI YGGCCR 1 cut(s) 279
Eam1104I CTCTTC 1 cut(s) 63
EarI CTCTTC 1 cut(s) 63
Eco130I CCWWGG 1 cut(s) 156
Eco32I GATATC 1 cut(s) 117
Eco81I CCTNAGG 1 cut(s) 24
EcoRII CCWGG 1 cut(s) 276
EcoRV GATATC 1 cut(s) 117
EcoT14I CCWWGG 1 cut(s) 156
EcoT22I ATGCAT 1 cut(s) 131
ErhI CCWWGG 1 cut(s) 156
Esp3I CGTCTC 1 cut(s) 242
FaeI CATG 5 cut(s) 47, 124, 129, 133, 294
FaiI YATR 5 cut(s) 45, 122, 127, 131, 292
FatI CATG 5 cut(s) 43, 120, 125, 129, 290
FblI GTMKAC 1 cut(s) 228
FokI GGATG 1 cut(s) 6
HaeIII GGCC 1 cut(s) 281
Hin1II CATG 5 cut(s) 47, 124, 129, 133, 294
HinfI GANTC 1 cut(s) 98
Hpy166II GTNNAC 1 cut(s) 229
Hpy188III TCNNGA 4 cut(s) 23, 146, 206, 291
Hpy8I GTNNAC 1 cut(s) 229
HpyCH4V TGCA 1 cut(s) 129
HpyF3I CTNAG 1 cut(s) 24
Hsp92II CATG 5 cut(s) 47, 124, 129, 133, 294
Kzo9I GATC 1 cut(s) 148
LmnI GCTCC 1 cut(s) 279
LpnPI CCDG 3 cut(s) 36, 263, 290
LweI GCATC 1 cut(s) 199
MalI GATC 1 cut(s) 150
MboI GATC 1 cut(s) 148
MboII GAAGA 3 cut(s) 59, 73, 80
MluCI AATT 1 cut(s) 136
MnlI CCTC 2 cut(s) 19, 184
Mph1103I ATGCAT 1 cut(s) 131
MseI TTAA 1 cut(s) 81
MspR9I CCNGG 1 cut(s) 278
MvaI CCWGG 1 cut(s) 278
NdeII GATC 1 cut(s) 148
NlaIII CATG 5 cut(s) 47, 124, 129, 133, 294
NlaIV GGNNCC 1 cut(s) 275
NsiI ATGCAT 1 cut(s) 131
NspI RCATGY 1 cut(s) 133
PaeI GCATGC 1 cut(s) 133
PagI TCATGA 1 cut(s) 290
PfeI GAWTC 1 cut(s) 98
Psp6I CCWGG 1 cut(s) 276
PspGI CCWGG 1 cut(s) 276
PspN4I GGNNCC 1 cut(s) 275
SaqAI TTAA 1 cut(s) 81
Sau3AI GATC 1 cut(s) 148
ScrFI CCNGG 1 cut(s) 278
SetI ASST 3 cut(s) 30, 97, 260
SfaNI GCATC 1 cut(s) 199
SphI GCATGC 1 cut(s) 133
Sse9I AATT 1 cut(s) 136
StyD4I CCNGG 1 cut(s) 276
StyI CCWWGG 1 cut(s) 156
TasI AATT 1 cut(s) 136
TfiI GAWTC 1 cut(s) 98
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TspDTI ATGAA 4 cut(s) 17, 60, 90, 279
TspGWI ACGGA 1 cut(s) 266
XceI RCATGY 1 cut(s) 133
XmiI GTMKAC 1 cut(s) 228
Zsp2I ATGCAT 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.