Rh3CG037400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
2537731 .. 2539184
1454 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG037400.1

Sequence Viewer

Length: 276 bp
ATGAACACCAAGAATGACCATCCTGAGGTGTGTGAAAAGGAACATGAAGAAGCCACTTTGAAGATTGAAGAGAAACTCATTAAGGACACGGAAGCTGATTCATTTATCACACCGATATCCATGTCATGCATGCCTAATTGTGTTCAAGATCAACCCAAGGAGAAGTCAATGTCCATTCCTTTTCAAGTGGAAGAGTTCAAGTTTCAAGATGCTTATTCTAAACTTGTCTACGGGTGTTCACACAAAAATCAGGAACTTTATATCGGTGAGATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.55

Weight (kDa)

4.76

Isoelectric Point (pI)

51.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 228
AfiI CCNNNNNNNGG 1 cut(s) 25
AgsI TTSAA 6 cut(s) 61, 68, 146, 185, 199, 206
AluBI AGCT 1 cut(s) 95
AluI AGCT 1 cut(s) 95
AxyI CCTNAGG 1 cut(s) 24
BccI CCATC 1 cut(s) 27
BglII AGATCT 1 cut(s) 270
BmsI GCATC 1 cut(s) 199
BsaJI CCNNGG 1 cut(s) 156
Bsc4I CCNNNNNNNGG 1 cut(s) 25
Bse21I CCTNAGG 1 cut(s) 24
BseDI CCNNGG 1 cut(s) 156
BseGI GGATG 1 cut(s) 19
BseLI CCNNNNNNNGG 1 cut(s) 25
BseMII CTCAG 1 cut(s) 15
BslI CCNNNNNNNGG 1 cut(s) 25
Bsp143I GATC 2 cut(s) 148, 270
BspCNI CTCAG 1 cut(s) 16
BssECI CCNNGG 1 cut(s) 156
BssMI GATC 2 cut(s) 148, 270
BssT1I CCWWGG 1 cut(s) 156
Bst6I CTCTTC 2 cut(s) 63, 186
BstC8I GCNNGC 1 cut(s) 131
BstDEI CTNAG 1 cut(s) 24
BstF5I GGATG 1 cut(s) 19
BstKTI GATC 2 cut(s) 151, 273
BstMBI GATC 2 cut(s) 148, 270
BstNSI RCATGY 1 cut(s) 133
BstX2I RGATCY 1 cut(s) 270
BstYI RGATCY 1 cut(s) 270
Bsu36I CCTNAGG 1 cut(s) 24
BtsCI GGATG 1 cut(s) 19
Cac8I GCNNGC 1 cut(s) 131
CviAII CATG 4 cut(s) 44, 121, 126, 130
CviJI RGCY 2 cut(s) 53, 95
CviKI_1 RGCY 2 cut(s) 53, 95
DdeI CTNAG 1 cut(s) 24
DpnI GATC 2 cut(s) 150, 272
DpnII GATC 2 cut(s) 148, 270
Eam1104I CTCTTC 2 cut(s) 63, 186
EarI CTCTTC 2 cut(s) 63, 186
Eco130I CCWWGG 1 cut(s) 156
Eco32I GATATC 1 cut(s) 117
Eco81I CCTNAGG 1 cut(s) 24
EcoRV GATATC 1 cut(s) 117
EcoT14I CCWWGG 1 cut(s) 156
EcoT22I ATGCAT 1 cut(s) 131
ErhI CCWWGG 1 cut(s) 156
FaeI CATG 4 cut(s) 47, 124, 129, 133
FaiI YATR 5 cut(s) 45, 122, 127, 131, 261
FatI CATG 4 cut(s) 43, 120, 125, 129
FblI GTMKAC 1 cut(s) 228
FokI GGATG 1 cut(s) 6
Hin1II CATG 4 cut(s) 47, 124, 129, 133
HinfI GANTC 1 cut(s) 98
Hpy166II GTNNAC 2 cut(s) 229, 239
Hpy188I TCNGA 1 cut(s) 275
Hpy188III TCNNGA 4 cut(s) 23, 146, 206, 251
Hpy8I GTNNAC 2 cut(s) 229, 239
HpyCH4V TGCA 1 cut(s) 129
HpyF3I CTNAG 1 cut(s) 24
Hsp92II CATG 4 cut(s) 47, 124, 129, 133
Kzo9I GATC 2 cut(s) 148, 270
LpnPI CCDG 2 cut(s) 36, 236
LweI GCATC 1 cut(s) 199
MalI GATC 2 cut(s) 150, 272
MboI GATC 2 cut(s) 148, 270
MboII GAAGA 4 cut(s) 59, 73, 80, 203
MflI RGATCY 1 cut(s) 270
MluCI AATT 1 cut(s) 136
MnlI CCTC 1 cut(s) 19
Mph1103I ATGCAT 1 cut(s) 131
MseI TTAA 1 cut(s) 81
NdeII GATC 2 cut(s) 148, 270
NlaIII CATG 4 cut(s) 47, 124, 129, 133
NsiI ATGCAT 1 cut(s) 131
NspI RCATGY 1 cut(s) 133
PaeI GCATGC 1 cut(s) 133
PfeI GAWTC 1 cut(s) 98
PsuI RGATCY 1 cut(s) 270
SaqAI TTAA 1 cut(s) 81
Sau3AI GATC 2 cut(s) 148, 270
SetI ASST 2 cut(s) 30, 97
SfaNI GCATC 1 cut(s) 199
SphI GCATGC 1 cut(s) 133
Sse9I AATT 1 cut(s) 136
StyI CCWWGG 1 cut(s) 156
TasI AATT 1 cut(s) 136
TfiI GAWTC 1 cut(s) 98
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TspDTI ATGAA 3 cut(s) 17, 60, 90
TspGWI ACGGA 1 cut(s) 104
XceI RCATGY 1 cut(s) 133
XmiI GTMKAC 1 cut(s) 228
Zsp2I ATGCAT 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.