Rmu_sc0002986.1_g000050

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002986.1
OG0001259
Physical Location & Seq
Reverse (-)
234840 .. 235214
375 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002986.1_g000050.1.cds

Sequence Viewer

Length: 375 bp
atgaacgtcaagaatgaacatactgaggtgtgtgaaaaggaacatgaagaagcaactttgaagattgaagagaaactcattaaggataaggaagctgattcattcatcacatcgatatccatgtcatgcatgcctaattgtgttcaagatcaacccaaggagaagtcattgcccattccttttcaagtggaggacttcaagtttcaagatgcttattctaaacttgtctatggtattggattcatggtgataccttttaatttagagaatattgaagttgatggcttatcatgttttattcctagtaatgatcgagctgcattcaagaggaactcaaggtcgagttcttttcaagtggaggagactgatgtatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

124

Amino Acids

14.2

Weight (kDa)

4.68

Isoelectric Point (pI)

54.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 9 cut(s) 61, 68, 146, 185, 199, 206, 275, 325, 353
AluBI AGCT 2 cut(s) 95, 317
AluI AGCT 2 cut(s) 95, 317
Alw26I GTCTC 1 cut(s) 356
ApeKI GCWGC 1 cut(s) 317
AsuHPI GGTGA 1 cut(s) 259
BbvI GCAGC 1 cut(s) 304
BccI CCATC 1 cut(s) 275
BcoDI GTCTC 1 cut(s) 356
BfaI CTAG 1 cut(s) 303
BisI GCNGC 1 cut(s) 318
BlsI GCNGC 1 cut(s) 319
BmsI GCATC 1 cut(s) 199
BpuEI CTTGAG 1 cut(s) 319
Bsa29I ATCGAT 1 cut(s) 113
BsaJI CCNNGG 1 cut(s) 156
Bse3DI GCAATG 1 cut(s) 167
BseCI ATCGAT 1 cut(s) 113
BseDI CCNNGG 1 cut(s) 156
BseMI GCAATG 1 cut(s) 167
BseMII CTCAG 1 cut(s) 15
BseRI GAGGAG 1 cut(s) 374
BseXI GCAGC 1 cut(s) 304
BshVI ATCGAT 1 cut(s) 113
BsmAI GTCTC 1 cut(s) 356
BsmI GAATGC 1 cut(s) 320
Bsp143I GATC 2 cut(s) 148, 310
BspCNI CTCAG 1 cut(s) 16
BspDI ATCGAT 1 cut(s) 113
BsrDI GCAATG 1 cut(s) 167
BssECI CCNNGG 1 cut(s) 156
BssMI GATC 2 cut(s) 148, 310
BssT1I CCWWGG 1 cut(s) 156
Bst6I CTCTTC 1 cut(s) 63
BstC8I GCNNGC 1 cut(s) 131
BstDEI CTNAG 1 cut(s) 24
BstKTI GATC 2 cut(s) 151, 313
BstMAI GTCTC 1 cut(s) 356
BstMBI GATC 2 cut(s) 148, 310
BstNSI RCATGY 1 cut(s) 133
BstV1I GCAGC 1 cut(s) 304
Bsu15I ATCGAT 1 cut(s) 113
BsuTUI ATCGAT 1 cut(s) 113
Cac8I GCNNGC 1 cut(s) 131
ClaI ATCGAT 1 cut(s) 113
CviAII CATG 6 cut(s) 44, 121, 126, 130, 244, 291
CviJI RGCY 3 cut(s) 95, 285, 317
CviKI_1 RGCY 3 cut(s) 95, 285, 317
DdeI CTNAG 1 cut(s) 24
DpnI GATC 2 cut(s) 150, 312
DpnII GATC 2 cut(s) 148, 310
Eam1104I CTCTTC 1 cut(s) 63
EarI CTCTTC 1 cut(s) 63
Eco130I CCWWGG 1 cut(s) 156
Eco32I GATATC 1 cut(s) 117
EcoRV GATATC 1 cut(s) 117
EcoT14I CCWWGG 1 cut(s) 156
EcoT22I ATGCAT 1 cut(s) 131
ErhI CCWWGG 1 cut(s) 156
FaeI CATG 6 cut(s) 47, 124, 129, 133, 247, 294
FaiI YATR 9 cut(s) 21, 45, 122, 127, 131, 231, 245, 292, 373
FatI CATG 6 cut(s) 43, 120, 125, 129, 243, 290
Fnu4HI GCNGC 1 cut(s) 318
Fsp4HI GCNGC 1 cut(s) 318
FspBI CTAG 1 cut(s) 303
GluI GCNGC 1 cut(s) 318
Hin1II CATG 6 cut(s) 47, 124, 129, 133, 247, 294
HinfI GANTC 2 cut(s) 98, 240
HphI GGTGA 1 cut(s) 259
Hpy188III TCNNGA 4 cut(s) 10, 146, 206, 325
HpyCH4IV ACGT 1 cut(s) 6
HpyCH4V TGCA 2 cut(s) 129, 320
HpyF3I CTNAG 1 cut(s) 24
HpySE526I ACGT 1 cut(s) 6
Hsp92II CATG 6 cut(s) 47, 124, 129, 133, 247, 294
Kzo9I GATC 2 cut(s) 148, 310
Lsp1109I GCAGC 1 cut(s) 304
LweI GCATC 1 cut(s) 199
MaeI CTAG 1 cut(s) 303
MaeII ACGT 1 cut(s) 6
MalI GATC 2 cut(s) 150, 312
MboI GATC 2 cut(s) 148, 310
MboII GAAGA 3 cut(s) 59, 73, 80
MluCI AATT 2 cut(s) 136, 259
MnlI CCTC 4 cut(s) 19, 184, 321, 352
Mph1103I ATGCAT 1 cut(s) 131
MseI TTAA 2 cut(s) 81, 258
Mva1269I GAATGC 1 cut(s) 320
NdeII GATC 2 cut(s) 148, 310
NlaIII CATG 6 cut(s) 47, 124, 129, 133, 247, 294
NsiI ATGCAT 1 cut(s) 131
NspI RCATGY 1 cut(s) 133
PaeI GCATGC 1 cut(s) 133
PctI GAATGC 1 cut(s) 320
PfeI GAWTC 2 cut(s) 98, 240
PkrI GCNGC 1 cut(s) 319
SaqAI TTAA 2 cut(s) 81, 258
SatI GCNGC 1 cut(s) 318
Sau3AI GATC 2 cut(s) 148, 310
SetI ASST 6 cut(s) 9, 30, 97, 256, 319, 341
SfaNI GCATC 1 cut(s) 199
SmlI CTYRAG 1 cut(s) 334
SmoI CTYRAG 1 cut(s) 334
SphI GCATGC 1 cut(s) 133
Sse9I AATT 2 cut(s) 136, 259
SspI AATATT 1 cut(s) 271
SspMI CTAG 1 cut(s) 303
StyI CCWWGG 1 cut(s) 156
TaiI ACGT 1 cut(s) 9
TaqI TCGA 3 cut(s) 113, 313, 341
TasI AATT 2 cut(s) 136, 259
TfiI GAWTC 2 cut(s) 98, 240
Tru1I TTAA 2 cut(s) 81, 258
Tru9I TTAA 2 cut(s) 81, 258
TseI GCWGC 1 cut(s) 317
TspDTI ATGAA 6 cut(s) 17, 30, 60, 90, 94, 232
XceI RCATGY 1 cut(s) 133
XspI CTAG 1 cut(s) 303
Zsp2I ATGCAT 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.