Rh2AG482400

Transcription elongation factor B polypeptide

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0001259
Physical Location & Seq
Forward (+)
70312876 .. 70314592
1717 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG482400.1

Sequence Viewer

Length: 396 bp
ATGGAACATGAAGAAGCCACTTTGAAGATTGAAGAGAAATTCATTAAGGACAAGGAAGCTGATTCATTCATCACATCGATATCCATGTCATGCATGCCTAATTGTGTTCAAGATCAACCCAAGGAGGAGTCAATGTCCATTCCTTTTCAAGTGGAGGAGTTCAAGTTTCAAGATGCTTATTCCAAACTTGTCTATGGTATTGGATTCATGGGTAGGGATTTGAGTCCAGTAACCGATGAGTTGTGGAAGAAATTCTATGAGAAGGAGTTTGGTATTGAGAGGACTAATCTGGTGATCGAAAGGATGAGGAAAAAGAAAGTCAATTCCAGATGGTTGCAATTGTATCAGGCCAAATTGAGGGAAGTGGATGAGGCTGAAAATGAAGCGGCTGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Elongin_A

Protein Analysis

131

Amino Acids

15.49

Weight (kDa)

4.92

Isoelectric Point (pI)

57.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Elongin_A PF06881 73 - 130 1.2e-07 RNA polymerase II transcription factor SIII (Elongin) subunit A
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 386
AcsI RAATTY 2 cut(s) 38, 251
AfiI CCNNNNNNNGG 1 cut(s) 357
AgsI TTSAA 6 cut(s) 25, 32, 110, 149, 163, 170
AluBI AGCT 1 cut(s) 59
AluI AGCT 1 cut(s) 59
AoxI GGCC 1 cut(s) 348
ApoI RAATTY 2 cut(s) 38, 251
Asp700I GAANNNNTTC 1 cut(s) 251
AsuHPI GGTGA 1 cut(s) 304
BccI CCATC 1 cut(s) 324
BisI GCNGC 1 cut(s) 387
BlsI GCNGC 1 cut(s) 388
BmsI GCATC 1 cut(s) 163
Bsa29I ATCGAT 1 cut(s) 77
BsaJI CCNNGG 1 cut(s) 120
BsaXI ACNNNNNCTCC 4 cut(s) 119, 149, 149, 179
Bsc4I CCNNNNNNNGG 1 cut(s) 357
Bse1I ACTGG 1 cut(s) 227
BseCI ATCGAT 1 cut(s) 77
BseDI CCNNGG 1 cut(s) 120
BseGI GGATG 2 cut(s) 309, 373
BseLI CCNNNNNNNGG 1 cut(s) 357
BseNI ACTGG 1 cut(s) 227
BseRI GAGGAG 2 cut(s) 140, 170
BshFI GGCC 1 cut(s) 350
BshVI ATCGAT 1 cut(s) 77
BslI CCNNNNNNNGG 1 cut(s) 357
BsnI GGCC 1 cut(s) 350
Bsp143I GATC 2 cut(s) 112, 294
BspACI CCGC 1 cut(s) 386
BspANI GGCC 1 cut(s) 350
BspDI ATCGAT 1 cut(s) 77
BsrI ACTGG 1 cut(s) 227
BssECI CCNNGG 1 cut(s) 120
BssMI GATC 2 cut(s) 112, 294
BssT1I CCWWGG 1 cut(s) 120
Bst6I CTCTTC 1 cut(s) 27
BstC8I GCNNGC 1 cut(s) 95
BstF5I GGATG 2 cut(s) 309, 373
BstKTI GATC 2 cut(s) 115, 297
BstMBI GATC 2 cut(s) 112, 294
BstNSI RCATGY 1 cut(s) 97
Bsu15I ATCGAT 1 cut(s) 77
BsuRI GGCC 1 cut(s) 350
BsuTUI ATCGAT 1 cut(s) 77
BtsCI GGATG 2 cut(s) 309, 373
Cac8I GCNNGC 1 cut(s) 95
ClaI ATCGAT 1 cut(s) 77
CviAII CATG 5 cut(s) 8, 85, 90, 94, 208
CviJI RGCY 5 cut(s) 17, 59, 350, 374, 389
CviKI_1 RGCY 5 cut(s) 17, 59, 350, 374, 389
DpnI GATC 2 cut(s) 114, 296
DpnII GATC 2 cut(s) 112, 294
Eam1104I CTCTTC 1 cut(s) 27
EarI CTCTTC 1 cut(s) 27
Eco130I CCWWGG 1 cut(s) 120
Eco32I GATATC 1 cut(s) 81
EcoRV GATATC 1 cut(s) 81
EcoT14I CCWWGG 1 cut(s) 120
EcoT22I ATGCAT 1 cut(s) 95
ErhI CCWWGG 1 cut(s) 120
FaeI CATG 5 cut(s) 11, 88, 93, 97, 211
FaiI YATR 7 cut(s) 9, 86, 91, 95, 195, 209, 258
FatI CATG 5 cut(s) 7, 84, 89, 93, 207
Fnu4HI GCNGC 1 cut(s) 387
FokI GGATG 2 cut(s) 316, 380
Fsp4HI GCNGC 1 cut(s) 387
GluI GCNGC 1 cut(s) 387
HaeIII GGCC 1 cut(s) 350
Hin1II CATG 5 cut(s) 11, 88, 93, 97, 211
HinfI GANTC 4 cut(s) 62, 128, 204, 223
HphI GGTGA 1 cut(s) 304
Hpy188III TCNNGA 3 cut(s) 110, 170, 327
HpyAV CCTTC 1 cut(s) 256
HpyCH4V TGCA 2 cut(s) 93, 337
Hsp92II CATG 5 cut(s) 11, 88, 93, 97, 211
Kzo9I GATC 2 cut(s) 112, 294
LpnPI CCDG 4 cut(s) 240, 275, 332, 340
LweI GCATC 1 cut(s) 163
MaeIII GTNAC 1 cut(s) 229
MalI GATC 2 cut(s) 114, 296
MboI GATC 2 cut(s) 112, 294
MboII GAAGA 4 cut(s) 23, 37, 44, 259
MfeI CAATTG 1 cut(s) 338
MluCI AATT 6 cut(s) 38, 100, 251, 322, 338, 353
MlyI GAGTC 2 cut(s) 137, 232
MnlI CCTC 6 cut(s) 118, 148, 273, 300, 351, 364
Mph1103I ATGCAT 1 cut(s) 95
MroXI GAANNNNTTC 1 cut(s) 251
MseI TTAA 1 cut(s) 45
MunI CAATTG 1 cut(s) 338
NdeII GATC 2 cut(s) 112, 294
NlaIII CATG 5 cut(s) 11, 88, 93, 97, 211
NsiI ATGCAT 1 cut(s) 95
NspI RCATGY 1 cut(s) 97
PaeI GCATGC 1 cut(s) 97
PdmI GAANNNNTTC 1 cut(s) 251
PfeI GAWTC 2 cut(s) 62, 204
PkrI GCNGC 1 cut(s) 388
PleI GAGTC 2 cut(s) 136, 231
PpsI GAGTC 2 cut(s) 136, 231
SaqAI TTAA 1 cut(s) 45
SatI GCNGC 1 cut(s) 387
Sau3AI GATC 2 cut(s) 112, 294
SchI GAGTC 2 cut(s) 137, 232
SetI ASST 1 cut(s) 61
SfaNI GCATC 1 cut(s) 163
SphI GCATGC 1 cut(s) 97
Sse9I AATT 6 cut(s) 38, 100, 251, 322, 338, 353
SsiI CCGC 1 cut(s) 386
StyI CCWWGG 1 cut(s) 120
TaqI TCGA 2 cut(s) 77, 297
TasI AATT 6 cut(s) 38, 100, 251, 322, 338, 353
TauI GCSGC 1 cut(s) 389
TfiI GAWTC 2 cut(s) 62, 204
Tru1I TTAA 1 cut(s) 45
Tru9I TTAA 1 cut(s) 45
TspDTI ATGAA 6 cut(s) 24, 31, 54, 58, 196, 396
XapI RAATTY 2 cut(s) 38, 251
XceI RCATGY 1 cut(s) 97
XmnI GAANNNNTTC 1 cut(s) 251
Zsp2I ATGCAT 1 cut(s) 95
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.