Rmu_sc0003627.1_g000009

Belongs to the glycosyl hydrolase 18 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003627.1
OG0001259
Physical Location & Seq
Forward (+)
32081 .. 34014
1934 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003627.1_g000009.1.cds

Sequence Viewer

Length: 1161 bp
atggacgacactgatatgctttttggaagaccatggcatgaaagcgtcaaaggtggttattgcaaagacaacacatatttatttaggtgggagtcgcacaaaattaaaatcaagcctggaaggaagaacatcaagaatgaccatcctgaggtgtgtgaaaaggaacatgaagaagccactctgaagattgaagagaaactcagtaaggacaaggaagctgatttattcatcacatcgatatccatgtcatgcatgcctaattgtgttcaagatcaacccaaggagaagtcaatgcccattccttttcaagtggaggagttcaagtttcaagatgcatattctaaacttgtctacggtattggactcatggtgataccttttaatttcgagaatattgaagttgatggcttatcatgttttattcctactaatgatagagctacatgcaagaggaactcgaggttgagttcttttcaagtggaggagactgatgtagtacgagattttagccaatttcaacaaaaaatctcgaaaagaaagaagcgtcttcacattaagaagaataatttgaatattggaaattggtgggagtcgcacaaaattaaaatcaagcatggaaggaagaacatcaaggatgaccatcctgaggtgtgtgaaaatgagcatgaagaagccactctgaagattgaagagaaactcattaaggacaaggaagctgattcattcatcacatcgatatccatgtcatgcatgcctaattgtgttcaagatcaacccaaagagaagtcaatacccattccttttcaagtggaggagttcaagtttcaagatgcatattctaaacatgtctacggtattggacttatggtgataccttttaatttcgagaatattgaagttgatggtttatcatgttttattcctactaatgatcgagctacatacaagaggaactcgaggtcgagttcttttcaagtggaggagactgatgtaggacgatattttagccaatttcaacaaaaaatctcgaaaagaaagaagcgtcttcacattaagaagaataatttgaatattgaaaattgctcatctcatatggctttcgacgctttgacggagcctcttactatcgtgttcacgcttcccgcatcaatctcacattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Glyco_hydro_18

Protein Analysis

386

Amino Acids

45.02

Weight (kDa)

7.57

Isoelectric Point (pI)

52.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 351, 849
AciI CCGC 1 cut(s) 1143
AcuI CTGAAG 2 cut(s) 203, 701
AfaI GTAC 1 cut(s) 498
AfiI CCNNNNNNNGG 2 cut(s) 148, 646
AflIII ACRYGT 1 cut(s) 844
AjnI CCWGG 1 cut(s) 115
AluBI AGCT 4 cut(s) 218, 440, 716, 938
AluI AGCT 4 cut(s) 218, 440, 716, 938
Alw26I GTCTC 2 cut(s) 479, 977
Ama87I CYCGRG 2 cut(s) 457, 955
AsuHPI GGTGA 2 cut(s) 382, 880
AvaI CYCGRG 2 cut(s) 457, 955
AxyI CCTNAGG 2 cut(s) 147, 645
BbsI GAAGAC 3 cut(s) 34, 539, 1037
BccI CCATC 4 cut(s) 150, 398, 648, 896
BciT130I CCWGG 1 cut(s) 117
BcoDI GTCTC 2 cut(s) 479, 977
Bme1390I CCNGG 1 cut(s) 117
BmeT110I CYCGRG 2 cut(s) 457, 955
BmiI GGNNCC 1 cut(s) 1116
BmrFI CCNGG 1 cut(s) 117
BmsI GCATC 3 cut(s) 322, 820, 1154
BpiI GAAGAC 3 cut(s) 34, 539, 1037
Bsa29I ATCGAT 2 cut(s) 236, 734
BsaBI GATNNNNATC 1 cut(s) 639
BsaJI CCNNGG 2 cut(s) 32, 279
BsaXI ACNNNNNCTCC 4 cut(s) 308, 338, 806, 836
Bsc4I CCNNNNNNNGG 2 cut(s) 148, 646
Bse21I CCTNAGG 2 cut(s) 147, 645
Bse8I GATNNNNATC 1 cut(s) 639
BseBI CCWGG 1 cut(s) 117
BseCI ATCGAT 2 cut(s) 236, 734
BseDI CCNNGG 2 cut(s) 32, 279
BseGI GGATG 3 cut(s) 142, 640, 640
BseJI GATNNNNATC 1 cut(s) 639
BseLI CCNNNNNNNGG 2 cut(s) 148, 646
BseMII CTCAG 3 cut(s) 138, 214, 636
BseRI GAGGAG 4 cut(s) 329, 497, 827, 995
BshVI ATCGAT 2 cut(s) 236, 734
BsiHKCI CYCGRG 2 cut(s) 457, 955
BslI CCNNNNNNNGG 2 cut(s) 148, 646
BsmAI GTCTC 2 cut(s) 479, 977
BsoBI CYCGRG 2 cut(s) 457, 955
Bsp143I GATC 3 cut(s) 271, 769, 931
Bsp19I CCATGG 1 cut(s) 32
BspACI CCGC 1 cut(s) 1143
BspCNI CTCAG 3 cut(s) 139, 213, 637
BspDI ATCGAT 2 cut(s) 236, 734
BspLI GGNNCC 1 cut(s) 1116
BssECI CCNNGG 2 cut(s) 32, 279
BssMI GATC 3 cut(s) 271, 769, 931
BssT1I CCWWGG 2 cut(s) 32, 279
Bst2UI CCWGG 1 cut(s) 117
Bst4CI ACNGT 2 cut(s) 356, 854
Bst6I CTCTTC 2 cut(s) 186, 684
BstC8I GCNNGC 2 cut(s) 254, 752
BstDEI CTNAG 3 cut(s) 147, 200, 645
BstDSI CCRYGG 1 cut(s) 32
BstF5I GGATG 3 cut(s) 142, 640, 640
BstKTI GATC 3 cut(s) 274, 772, 934
BstMAI GTCTC 2 cut(s) 479, 977
BstMBI GATC 3 cut(s) 271, 769, 931
BstMWI GCNNNNNNNGC 1 cut(s) 1103
BstNI CCWGG 1 cut(s) 117
BstNSI RCATGY 4 cut(s) 256, 447, 754, 848
BstSCI CCNGG 1 cut(s) 115
BstV2I GAAGAC 3 cut(s) 34, 539, 1037
Bsu15I ATCGAT 2 cut(s) 236, 734
Bsu36I CCTNAGG 2 cut(s) 147, 645
BsuTUI ATCGAT 2 cut(s) 236, 734
BtgI CCRYGG 1 cut(s) 32
BtsCI GGATG 3 cut(s) 142, 640, 640
BtsIMutI CAGTG 1 cut(s) 9
Cac8I GCNNGC 2 cut(s) 254, 752
ClaI ATCGAT 2 cut(s) 236, 734
CseI GACGC 4 cut(s) 34, 533, 1031, 1112
Csp6I GTAC 1 cut(s) 497
CviQI GTAC 1 cut(s) 497
DdeI CTNAG 3 cut(s) 147, 200, 645
DpnI GATC 3 cut(s) 273, 771, 933
DpnII GATC 3 cut(s) 271, 769, 931
Eam1104I CTCTTC 2 cut(s) 186, 684
EarI CTCTTC 2 cut(s) 186, 684
Eco130I CCWWGG 2 cut(s) 32, 279
Eco32I GATATC 2 cut(s) 240, 738
Eco57I CTGAAG 2 cut(s) 203, 701
Eco81I CCTNAGG 2 cut(s) 147, 645
Eco88I CYCGRG 2 cut(s) 457, 955
EcoRII CCWGG 1 cut(s) 115
EcoRV GATATC 2 cut(s) 240, 738
EcoT14I CCWWGG 2 cut(s) 32, 279
EcoT22I ATGCAT 4 cut(s) 254, 337, 752, 835
ErhI CCWWGG 2 cut(s) 32, 279
FauI CCCGC 1 cut(s) 1150
FauNDI CATATG 1 cut(s) 1092
FblI GTMKAC 2 cut(s) 351, 849
FokI GGATG 3 cut(s) 129, 627, 647
HgaI GACGC 4 cut(s) 34, 533, 1031, 1112
HinfI GANTC 4 cut(s) 92, 363, 590, 719
HphI GGTGA 2 cut(s) 382, 880
Hpy166II GTNNAC 3 cut(s) 352, 850, 1134
Hpy188I TCNGA 2 cut(s) 183, 681
Hpy8I GTNNAC 3 cut(s) 352, 850, 1134
Hpy99I CGWCG 1 cut(s) 1106
HpyAV CCTTC 2 cut(s) 114, 612
HpyCH4III ACNGT 2 cut(s) 356, 854
HpyCH4V TGCA 6 cut(s) 63, 252, 335, 447, 750, 833
HpyF10VI GCNNNNNNNGC 1 cut(s) 1103
HpyF3I CTNAG 3 cut(s) 147, 200, 645
Kzo9I GATC 3 cut(s) 271, 769, 931
LmnI GCTCC 1 cut(s) 1114
LpnPI CCDG 4 cut(s) 102, 129, 159, 657
LweI GCATC 3 cut(s) 322, 820, 1154
MalI GATC 3 cut(s) 273, 771, 933
MboI GATC 3 cut(s) 271, 769, 931
MlyI GAGTC 3 cut(s) 101, 357, 599
Mph1103I ATGCAT 4 cut(s) 254, 337, 752, 835
MseI TTAA 7 cut(s) 105, 381, 555, 603, 702, 879, 1053
MslI CAYNNNNRTG 1 cut(s) 14
MspR9I CCNGG 1 cut(s) 117
MvaI CCWGG 1 cut(s) 117
MwoI GCNNNNNNNGC 1 cut(s) 1103
NcoI CCATGG 1 cut(s) 32
NdeI CATATG 1 cut(s) 1092
NdeII GATC 3 cut(s) 271, 769, 931
NlaIV GGNNCC 1 cut(s) 1116
NsiI ATGCAT 4 cut(s) 254, 337, 752, 835
NspI RCATGY 4 cut(s) 256, 447, 754, 848
PaeI GCATGC 2 cut(s) 256, 754
PaeR7I CTCGAG 2 cut(s) 457, 955
PciI ACATGT 1 cut(s) 844
PfeI GAWTC 1 cut(s) 719
PleI GAGTC 3 cut(s) 100, 357, 598
PpsI GAGTC 3 cut(s) 100, 357, 598
PscI ACATGT 1 cut(s) 844
Psp6I CCWGG 1 cut(s) 115
PspGI CCWGG 1 cut(s) 115
PspN4I GGNNCC 1 cut(s) 1116
PspXI VCTCGAGB 2 cut(s) 457, 955
RsaI GTAC 1 cut(s) 498
RsaNI GTAC 1 cut(s) 497
RseI CAYNNNNRTG 1 cut(s) 14
SaqAI TTAA 7 cut(s) 105, 381, 555, 603, 702, 879, 1053
Sau3AI GATC 3 cut(s) 271, 769, 931
SchI GAGTC 3 cut(s) 101, 357, 599
ScrFI CCNGG 1 cut(s) 117
SfaNI GCATC 3 cut(s) 322, 820, 1154
Sfr274I CTCGAG 2 cut(s) 457, 955
SlaI CTCGAG 2 cut(s) 457, 955
SmiMI CAYNNNNRTG 1 cut(s) 14
SmlI CTYRAG 2 cut(s) 457, 955
SmoI CTYRAG 2 cut(s) 457, 955
SphI GCATGC 2 cut(s) 256, 754
SsiI CCGC 1 cut(s) 1143
SspI AATATT 4 cut(s) 394, 574, 892, 1072
StyD4I CCNGG 1 cut(s) 115
StyI CCWWGG 2 cut(s) 32, 279
TaaI ACNGT 2 cut(s) 356, 854
TfiI GAWTC 1 cut(s) 719
Tru1I TTAA 7 cut(s) 105, 381, 555, 603, 702, 879, 1053
Tru9I TTAA 7 cut(s) 105, 381, 555, 603, 702, 879, 1053
TscAI CASTG 1 cut(s) 16
TspDTI ATGAA 6 cut(s) 54, 183, 217, 681, 711, 715
TspGWI ACGGA 1 cut(s) 1127
TspRI CASTG 1 cut(s) 16
XceI RCATGY 4 cut(s) 256, 447, 754, 848
XhoI CTCGAG 2 cut(s) 457, 955
XmiI GTMKAC 2 cut(s) 351, 849
Zsp2I ATGCAT 4 cut(s) 254, 337, 752, 835
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.