Rh2AG563800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
OG0001259
Physical Location & Seq
Reverse (-)
79333638 .. 79336792
3155 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG563800.1

Sequence Viewer

Length: 270 bp
ATGAACACCAAGAATGACCATCCTGAGGTGTGTGAAAAGGAACATGAAGAAGCCACTTTGAAGATTGAAGAGAAACTCATTAAGGACACGGAAGCTGATTCATTTATCACACCGATATCCATGTCATGCATGCCTAATTGTGTTCAAGATCAACCCAAGGAGAAGTCAATGTCCATTCCTTTTCAAGTGGAAGAGTTCAAGTTTCAAGATGCTTATTCTAAACTTGTCTACGGTATTCGATTCATGGCAGCAAATCTAGGCTCCAGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

10.18

Weight (kDa)

4.81

Isoelectric Point (pI)

50.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 228
AfiI CCNNNNNNNGG 1 cut(s) 25
AgsI TTSAA 6 cut(s) 61, 68, 146, 185, 199, 206
AluBI AGCT 2 cut(s) 95, 267
AluI AGCT 2 cut(s) 95, 267
ApeKI GCWGC 1 cut(s) 248
AxyI CCTNAGG 1 cut(s) 24
BbvI GCAGC 1 cut(s) 260
BccI CCATC 1 cut(s) 27
BfaI CTAG 1 cut(s) 257
BisI GCNGC 1 cut(s) 249
BlsI GCNGC 1 cut(s) 250
BmiI GGNNCC 1 cut(s) 262
BmsI GCATC 1 cut(s) 199
BpmI CTGGAG 1 cut(s) 247
BsaJI CCNNGG 1 cut(s) 156
Bsc4I CCNNNNNNNGG 1 cut(s) 25
Bse21I CCTNAGG 1 cut(s) 24
BseDI CCNNGG 1 cut(s) 156
BseGI GGATG 1 cut(s) 19
BseLI CCNNNNNNNGG 1 cut(s) 25
BseMII CTCAG 1 cut(s) 15
BseXI GCAGC 1 cut(s) 260
BslI CCNNNNNNNGG 1 cut(s) 25
Bsp143I GATC 1 cut(s) 148
BspCNI CTCAG 1 cut(s) 16
BspLI GGNNCC 1 cut(s) 262
BssECI CCNNGG 1 cut(s) 156
BssMI GATC 1 cut(s) 148
BssT1I CCWWGG 1 cut(s) 156
Bst4CI ACNGT 1 cut(s) 233
Bst6I CTCTTC 2 cut(s) 63, 186
BstC8I GCNNGC 1 cut(s) 131
BstDEI CTNAG 1 cut(s) 24
BstF5I GGATG 1 cut(s) 19
BstKTI GATC 1 cut(s) 151
BstMBI GATC 1 cut(s) 148
BstNSI RCATGY 1 cut(s) 133
BstV1I GCAGC 1 cut(s) 260
Bsu36I CCTNAGG 1 cut(s) 24
BtsCI GGATG 1 cut(s) 19
Cac8I GCNNGC 1 cut(s) 131
CviAII CATG 5 cut(s) 44, 121, 126, 130, 244
CviJI RGCY 4 cut(s) 53, 95, 261, 267
CviKI_1 RGCY 4 cut(s) 53, 95, 261, 267
DdeI CTNAG 1 cut(s) 24
DpnI GATC 1 cut(s) 150
DpnII GATC 1 cut(s) 148
Eam1104I CTCTTC 2 cut(s) 63, 186
EarI CTCTTC 2 cut(s) 63, 186
Eco130I CCWWGG 1 cut(s) 156
Eco32I GATATC 1 cut(s) 117
Eco81I CCTNAGG 1 cut(s) 24
EcoRV GATATC 1 cut(s) 117
EcoT14I CCWWGG 1 cut(s) 156
EcoT22I ATGCAT 1 cut(s) 131
ErhI CCWWGG 1 cut(s) 156
FaeI CATG 5 cut(s) 47, 124, 129, 133, 247
FaiI YATR 5 cut(s) 45, 122, 127, 131, 245
FatI CATG 5 cut(s) 43, 120, 125, 129, 243
FblI GTMKAC 1 cut(s) 228
Fnu4HI GCNGC 1 cut(s) 249
FokI GGATG 1 cut(s) 6
Fsp4HI GCNGC 1 cut(s) 249
FspBI CTAG 1 cut(s) 257
GluI GCNGC 1 cut(s) 249
GsuI CTGGAG 1 cut(s) 247
Hin1II CATG 5 cut(s) 47, 124, 129, 133, 247
HinfI GANTC 2 cut(s) 98, 240
Hpy166II GTNNAC 1 cut(s) 229
Hpy188III TCNNGA 3 cut(s) 23, 146, 206
Hpy8I GTNNAC 1 cut(s) 229
HpyCH4III ACNGT 1 cut(s) 233
HpyCH4V TGCA 1 cut(s) 129
HpyF3I CTNAG 1 cut(s) 24
Hsp92II CATG 5 cut(s) 47, 124, 129, 133, 247
Kzo9I GATC 1 cut(s) 148
LmnI GCTCC 1 cut(s) 266
LpnPI CCDG 1 cut(s) 36
Lsp1109I GCAGC 1 cut(s) 260
LweI GCATC 1 cut(s) 199
MaeI CTAG 1 cut(s) 257
MalI GATC 1 cut(s) 150
MboI GATC 1 cut(s) 148
MboII GAAGA 4 cut(s) 59, 73, 80, 203
MluCI AATT 1 cut(s) 136
MnlI CCTC 1 cut(s) 19
Mph1103I ATGCAT 1 cut(s) 131
MseI TTAA 1 cut(s) 81
NdeII GATC 1 cut(s) 148
NlaIII CATG 5 cut(s) 47, 124, 129, 133, 247
NlaIV GGNNCC 1 cut(s) 262
NsiI ATGCAT 1 cut(s) 131
NspI RCATGY 1 cut(s) 133
PaeI GCATGC 1 cut(s) 133
PfeI GAWTC 2 cut(s) 98, 240
PkrI GCNGC 1 cut(s) 250
PspN4I GGNNCC 1 cut(s) 262
SaqAI TTAA 1 cut(s) 81
SatI GCNGC 1 cut(s) 249
Sau3AI GATC 1 cut(s) 148
SetI ASST 3 cut(s) 30, 97, 269
SfaNI GCATC 1 cut(s) 199
SphI GCATGC 1 cut(s) 133
Sse9I AATT 1 cut(s) 136
SspMI CTAG 1 cut(s) 257
StyI CCWWGG 1 cut(s) 156
TaaI ACNGT 1 cut(s) 233
TaqI TCGA 1 cut(s) 238
TasI AATT 1 cut(s) 136
TfiI GAWTC 2 cut(s) 98, 240
Tru1I TTAA 1 cut(s) 81
Tru9I TTAA 1 cut(s) 81
TseI GCWGC 1 cut(s) 248
TspDTI ATGAA 4 cut(s) 17, 60, 90, 232
TspGWI ACGGA 1 cut(s) 104
XceI RCATGY 1 cut(s) 133
XmiI GTMKAC 1 cut(s) 228
XspI CTAG 1 cut(s) 257
Zsp2I ATGCAT 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.