Rh5DG232400

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0001259
Physical Location & Seq
Forward (+)
26511389 .. 26512787
1399 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG232400.1

Sequence Viewer

Length: 240 bp
ATGTGTGAAAAGGAACATGAAGTAGCCACTTTGAAGATCGAAGAGAAACTCATTAAGGACAAAGAAGCTGATTCATTCATGACATTGATATCCTTGTCATGCATGTCTAATTGTGTTCAAGATCAACCCAAGGTGAAGTCAATGCCCATTCCTTTTCAAGTGGAGGAGTTCAAGTTTCAAGATGCTCATTCTAAACTTGTCTACGGTATTGGATTCATGATCAAAGTATCAGACCCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

79

Amino Acids

9.04

Weight (kDa)

5.27

Isoelectric Point (pI)

34.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 201
AgsI TTSAA 5 cut(s) 34, 119, 158, 172, 179
AluBI AGCT 1 cut(s) 68
AluI AGCT 1 cut(s) 68
AsuHPI GGTGA 1 cut(s) 145
BclI TGATCA 1 cut(s) 219
BmsI GCATC 1 cut(s) 172
BsaJI CCNNGG 1 cut(s) 129
BsaXI ACNNNNNCTCC 2 cut(s) 158, 188
BseDI CCNNGG 1 cut(s) 129
BseRI GAGGAG 1 cut(s) 179
Bsp143I GATC 3 cut(s) 36, 121, 219
BspHI TCATGA 2 cut(s) 78, 216
BssECI CCNNGG 1 cut(s) 129
BssMI GATC 3 cut(s) 36, 121, 219
BssT1I CCWWGG 1 cut(s) 129
Bst4CI ACNGT 1 cut(s) 206
Bst6I CTCTTC 1 cut(s) 36
BstKTI GATC 3 cut(s) 39, 124, 222
BstMBI GATC 3 cut(s) 36, 121, 219
BstNSI RCATGY 1 cut(s) 106
CciI TCATGA 2 cut(s) 78, 216
CviAII CATG 5 cut(s) 17, 79, 99, 103, 217
CviJI RGCY 2 cut(s) 26, 68
CviKI_1 RGCY 2 cut(s) 26, 68
DpnI GATC 3 cut(s) 38, 123, 221
DpnII GATC 3 cut(s) 36, 121, 219
Eam1104I CTCTTC 1 cut(s) 36
EarI CTCTTC 1 cut(s) 36
Eco130I CCWWGG 1 cut(s) 129
Eco32I GATATC 1 cut(s) 90
EcoRV GATATC 1 cut(s) 90
EcoT14I CCWWGG 1 cut(s) 129
EcoT22I ATGCAT 1 cut(s) 104
ErhI CCWWGG 1 cut(s) 129
FaeI CATG 5 cut(s) 20, 82, 102, 106, 220
FaiI YATR 6 cut(s) 18, 80, 100, 104, 218, 238
FatI CATG 5 cut(s) 16, 78, 98, 102, 216
FbaI TGATCA 1 cut(s) 219
FblI GTMKAC 1 cut(s) 201
Hin1II CATG 5 cut(s) 20, 82, 102, 106, 220
HinfI GANTC 2 cut(s) 71, 213
HphI GGTGA 1 cut(s) 145
Hpy166II GTNNAC 1 cut(s) 202
Hpy188I TCNGA 1 cut(s) 232
Hpy188III TCNNGA 4 cut(s) 79, 119, 179, 217
Hpy8I GTNNAC 1 cut(s) 202
HpyCH4III ACNGT 1 cut(s) 206
HpyCH4V TGCA 1 cut(s) 102
Hsp92II CATG 5 cut(s) 20, 82, 102, 106, 220
Ksp22I TGATCA 1 cut(s) 219
Kzo9I GATC 3 cut(s) 36, 121, 219
LweI GCATC 1 cut(s) 172
MalI GATC 3 cut(s) 38, 123, 221
MboI GATC 3 cut(s) 36, 121, 219
MboII GAAGA 2 cut(s) 46, 53
MluCI AATT 1 cut(s) 109
MnlI CCTC 1 cut(s) 157
Mph1103I ATGCAT 1 cut(s) 104
MseI TTAA 1 cut(s) 54
NdeII GATC 3 cut(s) 36, 121, 219
NlaIII CATG 5 cut(s) 20, 82, 102, 106, 220
NsiI ATGCAT 1 cut(s) 104
NspI RCATGY 1 cut(s) 106
PagI TCATGA 2 cut(s) 78, 216
PfeI GAWTC 2 cut(s) 71, 213
SaqAI TTAA 1 cut(s) 54
Sau3AI GATC 3 cut(s) 36, 121, 219
SetI ASST 2 cut(s) 70, 135
SfaNI GCATC 1 cut(s) 172
Sse9I AATT 1 cut(s) 109
StyI CCWWGG 1 cut(s) 129
TaaI ACNGT 1 cut(s) 206
TaqI TCGA 1 cut(s) 39
TasI AATT 1 cut(s) 109
TfiI GAWTC 2 cut(s) 71, 213
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
TspDTI ATGAA 4 cut(s) 33, 63, 67, 205
XceI RCATGY 1 cut(s) 106
XmiI GTMKAC 1 cut(s) 201
Zsp2I ATGCAT 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.