Rmu_co8205962.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8205962.1
Physical Location & Seq
Reverse (-)
1 .. 278
278 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8205962.1_g000001.1.cds

Sequence Viewer

Length: 247 bp
atgaagcctggaaggaagaacctcaagaatgaccatcctgaggtgtgtgaaaaggaacatgaagaagccactttgaagattgaggagaaactcattaaggacaaggaagctgattcattcatcacattgatatccatgtcacgcatgcctaattgtattcaagatcaacccaaggaaaagtcaatgcccattccttttcaagtggaggagttcaagtttcaagatgattattctaaacttgtctacg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

9.72

Weight (kDa)

5.38

Isoelectric Point (pI)

44.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 243
AfiI CCNNNNNNNGG 1 cut(s) 40
AgsI TTSAA 5 cut(s) 76, 161, 200, 214, 221
AjnI CCWGG 1 cut(s) 7
AluBI AGCT 1 cut(s) 110
AluI AGCT 1 cut(s) 110
AxyI CCTNAGG 1 cut(s) 39
BccI CCATC 1 cut(s) 42
BciT130I CCWGG 1 cut(s) 9
Bme1390I CCNGG 1 cut(s) 9
BmrFI CCNGG 1 cut(s) 9
BpuEI CTTGAG 1 cut(s) 8
BsaJI CCNNGG 1 cut(s) 171
BsaXI ACNNNNNCTCC 2 cut(s) 200, 230
Bsc4I CCNNNNNNNGG 1 cut(s) 40
Bse21I CCTNAGG 1 cut(s) 39
BseBI CCWGG 1 cut(s) 9
BseDI CCNNGG 1 cut(s) 171
BseGI GGATG 1 cut(s) 34
BseLI CCNNNNNNNGG 1 cut(s) 40
BseMII CTCAG 1 cut(s) 30
BseRI GAGGAG 2 cut(s) 98, 221
BslI CCNNNNNNNGG 1 cut(s) 40
Bsp143I GATC 1 cut(s) 163
BspCNI CTCAG 1 cut(s) 31
BssECI CCNNGG 1 cut(s) 171
BssMI GATC 1 cut(s) 163
BssT1I CCWWGG 1 cut(s) 171
Bst2UI CCWGG 1 cut(s) 9
BstC8I GCNNGC 1 cut(s) 146
BstDEI CTNAG 1 cut(s) 39
BstF5I GGATG 1 cut(s) 34
BstKTI GATC 1 cut(s) 166
BstMBI GATC 1 cut(s) 163
BstNI CCWGG 1 cut(s) 9
BstNSI RCATGY 1 cut(s) 148
BstSCI CCNGG 1 cut(s) 7
Bsu36I CCTNAGG 1 cut(s) 39
BtsCI GGATG 1 cut(s) 34
Cac8I GCNNGC 1 cut(s) 146
CviAII CATG 3 cut(s) 59, 136, 145
CviJI RGCY 3 cut(s) 7, 68, 110
CviKI_1 RGCY 3 cut(s) 7, 68, 110
DdeI CTNAG 1 cut(s) 39
DpnI GATC 1 cut(s) 165
DpnII GATC 1 cut(s) 163
Eco130I CCWWGG 1 cut(s) 171
Eco32I GATATC 1 cut(s) 132
Eco81I CCTNAGG 1 cut(s) 39
EcoRII CCWGG 1 cut(s) 7
EcoRV GATATC 1 cut(s) 132
EcoT14I CCWWGG 1 cut(s) 171
ErhI CCWWGG 1 cut(s) 171
FaeI CATG 3 cut(s) 62, 139, 148
FaiI YATR 3 cut(s) 60, 137, 146
FatI CATG 3 cut(s) 58, 135, 144
FblI GTMKAC 1 cut(s) 243
FokI GGATG 1 cut(s) 21
Hin1II CATG 3 cut(s) 62, 139, 148
HinfI GANTC 1 cut(s) 113
Hpy166II GTNNAC 1 cut(s) 244
Hpy188III TCNNGA 4 cut(s) 25, 38, 161, 221
Hpy8I GTNNAC 1 cut(s) 244
HpyAV CCTTC 1 cut(s) 6
HpyF3I CTNAG 1 cut(s) 39
Hsp92II CATG 3 cut(s) 62, 139, 148
Kzo9I GATC 1 cut(s) 163
LpnPI CCDG 2 cut(s) 21, 51
MaeIII GTNAC 1 cut(s) 138
MalI GATC 1 cut(s) 165
MboI GATC 1 cut(s) 163
MboII GAAGA 3 cut(s) 28, 74, 88
MluCI AATT 1 cut(s) 151
MnlI CCTC 4 cut(s) 32, 34, 76, 199
MseI TTAA 1 cut(s) 96
MspR9I CCNGG 1 cut(s) 9
MvaI CCWGG 1 cut(s) 9
NdeII GATC 1 cut(s) 163
NlaIII CATG 3 cut(s) 62, 139, 148
NmuCI GTSAC 1 cut(s) 138
NspI RCATGY 1 cut(s) 148
PaeI GCATGC 1 cut(s) 148
PfeI GAWTC 1 cut(s) 113
Psp6I CCWGG 1 cut(s) 7
PspGI CCWGG 1 cut(s) 7
SaqAI TTAA 1 cut(s) 96
Sau3AI GATC 1 cut(s) 163
ScrFI CCNGG 1 cut(s) 9
SetI ASST 3 cut(s) 24, 45, 112
SmlI CTYRAG 1 cut(s) 23
SmoI CTYRAG 1 cut(s) 23
SphI GCATGC 1 cut(s) 148
Sse9I AATT 1 cut(s) 151
StyD4I CCNGG 1 cut(s) 7
StyI CCWWGG 1 cut(s) 171
TasI AATT 1 cut(s) 151
TfiI GAWTC 1 cut(s) 113
Tru1I TTAA 1 cut(s) 96
Tru9I TTAA 1 cut(s) 96
TseFI GTSAC 1 cut(s) 138
Tsp45I GTSAC 1 cut(s) 138
TspDTI ATGAA 4 cut(s) 17, 75, 105, 109
XceI RCATGY 1 cut(s) 148
XmiI GTMKAC 1 cut(s) 243
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.