Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0006770.1

Orthogroup ID

OG0001259

Physical Location & Seq

Genomic Coordinates Forward (+)

41124 .. 41657

Gene Structure 534 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0006770.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 534 bp

atgaacatcaagaatgaccatcctgaggtgtgtgaaaaggaacatgaagaagccactttaaatattgaagagaaactcattaaggacacggaagctgattcattcatcacactgatatccatgtcatgcatgcctaattgtgttcaagatcaacccaaggagaagtcaatgctcattccttttcaagtggaggagttcgagtttcaagatgcttattctaaacttgtctacggtattggattcatggtgataccttttaatttcaaaaatattgaagttgatggcttatcatgttttattcctactaacgatcgagctgcatacaagaggaactcgaggtcgagttcttttcaggtggaggagactgatgtaggacgagattttagccaacttcaacaaagaatctcgaaaagaaagaagcgtctgcacattaagaagaatgataagttgaatattgaaaattggtattcaaataggcttcttaatgatggaattaatcataaattactcttttggatatatcggaattcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Glyco_hydro_18

Protein Analysis

177

Amino Acids

20.88

Weight (kDa)

6.12

Isoelectric Point (pI)

58.46

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001259)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G13320
fragaria_vesca	FvH4_5g25692
rosa_chinensis	RchiOBHm_Chr2g0137451 RchiOBHm_Chr2g0160931 RchiOBHm_Chr3g0448801 RchiOBHm_Chr3g0478501 RchiOBHm_Chr4g0401031 RchiOBHm_Chr4g0434691 RchiOBHm_Chr5g0023581 RchiOBHm_Chr5g0058431 RchiOBHm_Chr6g0250181 RchiOBHm_Chr6g0290461 RchiOBHm_Chr6g0300101 RchiOBHm_Chr6g0310791 RchiOBHm_Chr7g0197901 RchiOBHm_Chr7g0228641
rosa_multiflora	Rmu_co8205962.1_g000001 Rmu_sc0000423.1_g000017 Rmu_sc0000639.1_g000014 Rmu_sc0000753.1_g000043 Rmu_sc0001023.1_g000036 Rmu_sc0001492.1_g000004 Rmu_sc0002038.1_g000025 Rmu_sc0002761.1_g000007 Rmu_sc0002986.1_g000050 Rmu_sc0003383.1_g000016 Rmu_sc0003627.1_g000009 Rmu_sc0004345.1_g000005 Rmu_sc0006770.1_g000009 Rmu_sc0008421.1_g000002 Rmu_sc0020916.1_g000001 Rmu_sc0026853.1_g000001 Rmu_ssc0000225.1_g000001 Rmu_ssc0000446.1_g000021
rosa_roxburghii	Rroxscaffold_1G00014750 Rroxscaffold_1G00022410 Rroxscaffold_2G00095780 Rroxscaffold_2G00135550 Rroxscaffold_4G00325760 Rroxscaffold_4G00331060 Rroxscaffold_6G00402470 Rroxscaffold_6G00427850
rosa_samantha	Rh1DG013300 Rh2AG039600 Rh2AG319100 Rh2AG482400 Rh2AG563800 Rh3CG037400 Rh4DG115600 Rh5DG036700 Rh5DG232400 Rh5DG570600 Rh6CG188400 Rh7DG052000 Rh7DG402600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	228
AcsI	RAATTY	1 cut(s)	526
AfiI	CCNNNNNNNGG	1 cut(s)	25
AluBI	AGCT	2 cut(s)	95, 317
AluI	AGCT	2 cut(s)	95, 317
Alw26I	GTCTC	1 cut(s)	356
Ama87I	CYCGRG	1 cut(s)	334
ApeKI	GCWGC	1 cut(s)	317
ApoI	RAATTY	1 cut(s)	526
AseI	ATTAAT	1 cut(s)	495
AsuHPI	GGTGA	1 cut(s)	259
AvaI	CYCGRG	1 cut(s)	334
AxyI	CCTNAGG	1 cut(s)	24
BbvI	GCAGC	1 cut(s)	304
BccI	CCATC	3 cut(s)	27, 275, 482
BcgI	CGANNNNNNTGC	2 cut(s)	299, 333
BcoDI	GTCTC	1 cut(s)	356
BisI	GCNGC	1 cut(s)	318
BlsI	GCNGC	1 cut(s)	319
BmeT110I	CYCGRG	1 cut(s)	334
BmsI	GCATC	1 cut(s)	199
BsaJI	CCNNGG	1 cut(s)	156
BsaXI	ACNNNNNCTCC	2 cut(s)	185, 215
Bsc4I	CCNNNNNNNGG	1 cut(s)	25
Bse21I	CCTNAGG	1 cut(s)	24
BseDI	CCNNGG	1 cut(s)	156
BseGI	GGATG	1 cut(s)	19
BseLI	CCNNNNNNNGG	1 cut(s)	25
BseMII	CTCAG	1 cut(s)	15
BseRI	GAGGAG	2 cut(s)	206, 374
BseXI	GCAGC	1 cut(s)	304
BsgI	GTGCAG	1 cut(s)	410
Bsh1285I	CGRYCG	1 cut(s)	313
BsiEI	CGRYCG	1 cut(s)	313
BsiHKCI	CYCGRG	1 cut(s)	334
BslI	CCNNNNNNNGG	1 cut(s)	25
BsmAI	GTCTC	1 cut(s)	356
BsoBI	CYCGRG	1 cut(s)	334
Bsp143I	GATC	2 cut(s)	148, 310
BspCNI	CTCAG	1 cut(s)	16
BssECI	CCNNGG	1 cut(s)	156
BssMI	GATC	2 cut(s)	148, 310
BssT1I	CCWWGG	1 cut(s)	156
Bst4CI	ACNGT	1 cut(s)	233
Bst6I	CTCTTC	1 cut(s)	63
BstC8I	GCNNGC	1 cut(s)	131
BstDEI	CTNAG	1 cut(s)	24
BstF5I	GGATG	1 cut(s)	19
BstKTI	GATC	2 cut(s)	151, 313
BstMAI	GTCTC	1 cut(s)	356
BstMBI	GATC	2 cut(s)	148, 310
BstMCI	CGRYCG	1 cut(s)	313
BstNSI	RCATGY	1 cut(s)	133
BstV1I	GCAGC	1 cut(s)	304
Bsu36I	CCTNAGG	1 cut(s)	24
BtsCI	GGATG	1 cut(s)	19
BtsIMutI	CAGTG	1 cut(s)	110
Cac8I	GCNNGC	1 cut(s)	131
CseI	GACGC	1 cut(s)	410
CviAII	CATG	6 cut(s)	44, 121, 126, 130, 244, 291
CviJI	RGCY	6 cut(s)	53, 95, 285, 317, 387, 478
CviKI_1	RGCY	6 cut(s)	53, 95, 285, 317, 387, 478
DdeI	CTNAG	1 cut(s)	24
DpnI	GATC	2 cut(s)	150, 312
DpnII	GATC	2 cut(s)	148, 310
DraI	TTTAAA	1 cut(s)	60
Eam1104I	CTCTTC	1 cut(s)	63
EarI	CTCTTC	1 cut(s)	63
Eco130I	CCWWGG	1 cut(s)	156
Eco32I	GATATC	1 cut(s)	117
Eco81I	CCTNAGG	1 cut(s)	24
Eco88I	CYCGRG	1 cut(s)	334
EcoRI	GAATTC	1 cut(s)	526
EcoRV	GATATC	1 cut(s)	117
EcoT14I	CCWWGG	1 cut(s)	156
EcoT22I	ATGCAT	1 cut(s)	131
ErhI	CCWWGG	1 cut(s)	156
FaeI	CATG	6 cut(s)	47, 124, 129, 133, 247, 294
FaiI	YATR	9 cut(s)	45, 122, 127, 131, 245, 292, 322, 501, 520
FatI	CATG	6 cut(s)	43, 120, 125, 129, 243, 290
FblI	GTMKAC	1 cut(s)	228
Fnu4HI	GCNGC	1 cut(s)	318
FokI	GGATG	1 cut(s)	6
Fsp4HI	GCNGC	1 cut(s)	318
GluI	GCNGC	1 cut(s)	318
HgaI	GACGC	1 cut(s)	410
Hin1II	CATG	6 cut(s)	47, 124, 129, 133, 247, 294
HinfI	GANTC	3 cut(s)	98, 240, 402
HphI	GGTGA	1 cut(s)	259
Hpy166II	GTNNAC	1 cut(s)	229
Hpy188I	TCNGA	1 cut(s)	525
Hpy188III	TCNNGA	6 cut(s)	10, 23, 146, 206, 406, 531
Hpy8I	GTNNAC	1 cut(s)	229
HpyCH4III	ACNGT	1 cut(s)	233
HpyCH4V	TGCA	3 cut(s)	129, 320, 427
HpyF3I	CTNAG	1 cut(s)	24
Hsp92II	CATG	6 cut(s)	47, 124, 129, 133, 247, 294
Kzo9I	GATC	2 cut(s)	148, 310
LpnPI	CCDG	2 cut(s)	36, 338
Lsp1109I	GCAGC	1 cut(s)	304
LweI	GCATC	1 cut(s)	199
MalI	GATC	2 cut(s)	150, 312
MboI	GATC	2 cut(s)	148, 310
MboII	GAAGA	3 cut(s)	59, 80, 448
MluCI	AATT	6 cut(s)	136, 259, 460, 492, 503, 526
MnlI	CCTC	5 cut(s)	19, 184, 321, 330, 352
Mph1103I	ATGCAT	1 cut(s)	131
MseI	TTAA	6 cut(s)	59, 81, 258, 432, 483, 495
NdeII	GATC	2 cut(s)	148, 310
NlaIII	CATG	6 cut(s)	47, 124, 129, 133, 247, 294
NsiI	ATGCAT	1 cut(s)	131
NspI	RCATGY	1 cut(s)	133
PaeI	GCATGC	1 cut(s)	133
PaeR7I	CTCGAG	1 cut(s)	334
PfeI	GAWTC	3 cut(s)	98, 240, 402
PkrI	GCNGC	1 cut(s)	319
Ple19I	CGATCG	1 cut(s)	313
PshBI	ATTAAT	1 cut(s)	495
PspXI	VCTCGAGB	1 cut(s)	334
PvuI	CGATCG	1 cut(s)	313
SaqAI	TTAA	6 cut(s)	59, 81, 258, 432, 483, 495
SatI	GCNGC	1 cut(s)	318
Sau3AI	GATC	2 cut(s)	148, 310
SetI	ASST	6 cut(s)	30, 97, 256, 319, 341, 357
SfaNI	GCATC	1 cut(s)	199
Sfr274I	CTCGAG	1 cut(s)	334
SlaI	CTCGAG	1 cut(s)	334
SmlI	CTYRAG	1 cut(s)	334
SmoI	CTYRAG	1 cut(s)	334
SphI	GCATGC	1 cut(s)	133
Sse9I	AATT	6 cut(s)	136, 259, 460, 492, 503, 526
SspI	AATATT	3 cut(s)	64, 271, 454
StyI	CCWWGG	1 cut(s)	156
TaaI	ACNGT	1 cut(s)	233
TaqI	TCGA	5 cut(s)	198, 313, 335, 341, 407
TasI	AATT	6 cut(s)	136, 259, 460, 492, 503, 526
TfiI	GAWTC	3 cut(s)	98, 240, 402
Tru1I	TTAA	6 cut(s)	59, 81, 258, 432, 483, 495
Tru9I	TTAA	6 cut(s)	59, 81, 258, 432, 483, 495
TscAI	CASTG	1 cut(s)	117
TseI	GCWGC	1 cut(s)	317
TspDTI	ATGAA	5 cut(s)	17, 60, 90, 94, 232
TspGWI	ACGGA	1 cut(s)	104
TspRI	CASTG	1 cut(s)	117
VspI	ATTAAT	1 cut(s)	495
XapI	RAATTY	1 cut(s)	526
XceI	RCATGY	1 cut(s)	133
XhoI	CTCGAG	1 cut(s)	334
XmiI	GTMKAC	1 cut(s)	228
Zsp2I	ATGCAT	1 cut(s)	131

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.