Rmu_sc0001492.1_g000004

Belongs to the glycosyl hydrolase 18 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001492.1
OG0001259
Physical Location & Seq
Reverse (-)
16938 .. 17441
504 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001492.1_g000004.1.cds

Sequence Viewer

Length: 504 bp
atgaacatcaagaatgaccatcctgaggtgtgtgaaaaggaacatgaagaagccactttgaagattgaagagaaactcattaaggacacggaagctgattctgttcaagatcaacccatggagaagtcaatgcccatttcttttcaagtggaggagttcaagtttcaagatgcttattctaaacttgtctacagtattggattcatggtgataccatttaattttgagaatattgaagttgatggcttatcatgttttattcccactaatgatcgagctgcatacaagaggaactcgaggtcgagttcttttcaagtggaggagactgatgtaggacgagattttagccaatttcaaccaaaaatctcgaaaagaaataagcgtattcacattaagaagaataatttgaatattggaaattggtattcaaataggcttcttaatgatggaattaatcataaattactcttttggatatatcgggattctcgagtaaaatcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Glyco_hydro_18

Protein Analysis

167

Amino Acids

19.69

Weight (kDa)

6.44

Isoelectric Point (pI)

50.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 189
AfiI CCNNNNNNNGG 1 cut(s) 25
AluBI AGCT 2 cut(s) 95, 278
AluI AGCT 2 cut(s) 95, 278
Alw26I GTCTC 1 cut(s) 317
Ama87I CYCGRG 2 cut(s) 295, 489
ApeKI GCWGC 1 cut(s) 278
AseI ATTAAT 1 cut(s) 453
AsuHPI GGTGA 1 cut(s) 220
AvaI CYCGRG 2 cut(s) 295, 489
AxyI CCTNAGG 1 cut(s) 24
BbvI GCAGC 1 cut(s) 265
BccI CCATC 3 cut(s) 27, 236, 440
BcoDI GTCTC 1 cut(s) 317
BfmI CTRYAG 1 cut(s) 190
BisI GCNGC 1 cut(s) 279
BlsI GCNGC 1 cut(s) 280
BmeT110I CYCGRG 2 cut(s) 295, 489
BmsI GCATC 1 cut(s) 160
BsaJI CCNNGG 1 cut(s) 117
BsaXI ACNNNNNCTCC 2 cut(s) 146, 176
Bsc4I CCNNNNNNNGG 1 cut(s) 25
Bse21I CCTNAGG 1 cut(s) 24
BseDI CCNNGG 1 cut(s) 117
BseGI GGATG 1 cut(s) 19
BseLI CCNNNNNNNGG 1 cut(s) 25
BseMII CTCAG 1 cut(s) 15
BseRI GAGGAG 2 cut(s) 167, 335
BseXI GCAGC 1 cut(s) 265
BsiHKCI CYCGRG 2 cut(s) 295, 489
BslI CCNNNNNNNGG 1 cut(s) 25
BsmAI GTCTC 1 cut(s) 317
BsoBI CYCGRG 2 cut(s) 295, 489
Bsp143I GATC 2 cut(s) 109, 271
Bsp19I CCATGG 1 cut(s) 117
BspCNI CTCAG 1 cut(s) 16
BssECI CCNNGG 1 cut(s) 117
BssMI GATC 2 cut(s) 109, 271
BssT1I CCWWGG 1 cut(s) 117
Bst4CI ACNGT 1 cut(s) 194
Bst6I CTCTTC 1 cut(s) 63
BstDEI CTNAG 1 cut(s) 24
BstDSI CCRYGG 1 cut(s) 117
BstF5I GGATG 1 cut(s) 19
BstKTI GATC 2 cut(s) 112, 274
BstMAI GTCTC 1 cut(s) 317
BstMBI GATC 2 cut(s) 109, 271
BstSFI CTRYAG 1 cut(s) 190
BstV1I GCAGC 1 cut(s) 265
Bsu36I CCTNAGG 1 cut(s) 24
BtgI CCRYGG 1 cut(s) 117
BtsCI GGATG 1 cut(s) 19
CviAII CATG 4 cut(s) 44, 118, 205, 252
CviJI RGCY 6 cut(s) 53, 95, 246, 278, 348, 436
CviKI_1 RGCY 6 cut(s) 53, 95, 246, 278, 348, 436
DdeI CTNAG 1 cut(s) 24
DpnI GATC 2 cut(s) 111, 273
DpnII GATC 2 cut(s) 109, 271
Eam1104I CTCTTC 1 cut(s) 63
EarI CTCTTC 1 cut(s) 63
Eco130I CCWWGG 1 cut(s) 117
Eco81I CCTNAGG 1 cut(s) 24
Eco88I CYCGRG 2 cut(s) 295, 489
EcoT14I CCWWGG 1 cut(s) 117
ErhI CCWWGG 1 cut(s) 117
FaeI CATG 4 cut(s) 47, 121, 208, 255
FaiI YATR 7 cut(s) 45, 119, 206, 253, 283, 459, 478
FatI CATG 4 cut(s) 43, 117, 204, 251
FblI GTMKAC 1 cut(s) 189
Fnu4HI GCNGC 1 cut(s) 279
FokI GGATG 1 cut(s) 6
Fsp4HI GCNGC 1 cut(s) 279
GluI GCNGC 1 cut(s) 279
Hin1II CATG 4 cut(s) 47, 121, 208, 255
HinfI GANTC 3 cut(s) 98, 201, 485
HphI GGTGA 1 cut(s) 220
Hpy166II GTNNAC 1 cut(s) 190
Hpy188III TCNNGA 8 cut(s) 10, 23, 107, 167, 367, 482, 489, 501
Hpy8I GTNNAC 1 cut(s) 190
HpyCH4III ACNGT 1 cut(s) 194
HpyCH4V TGCA 1 cut(s) 281
HpyF3I CTNAG 1 cut(s) 24
Hsp92II CATG 4 cut(s) 47, 121, 208, 255
Kzo9I GATC 2 cut(s) 109, 271
LpnPI CCDG 1 cut(s) 36
Lsp1109I GCAGC 1 cut(s) 265
LweI GCATC 1 cut(s) 160
MalI GATC 2 cut(s) 111, 273
MboI GATC 2 cut(s) 109, 271
MboII GAAGA 4 cut(s) 59, 73, 80, 409
MluCI AATT 6 cut(s) 220, 350, 403, 418, 450, 461
MnlI CCTC 5 cut(s) 19, 145, 282, 291, 313
MseI TTAA 5 cut(s) 81, 219, 393, 441, 453
NcoI CCATGG 1 cut(s) 117
NdeII GATC 2 cut(s) 109, 271
NlaIII CATG 4 cut(s) 47, 121, 208, 255
PaeR7I CTCGAG 2 cut(s) 295, 489
PcsI WCGNNNNNNNCGW 1 cut(s) 487
PfeI GAWTC 3 cut(s) 98, 201, 485
PkrI GCNGC 1 cut(s) 280
PshBI ATTAAT 1 cut(s) 453
PspXI VCTCGAGB 1 cut(s) 295
SaqAI TTAA 5 cut(s) 81, 219, 393, 441, 453
SatI GCNGC 1 cut(s) 279
Sau3AI GATC 2 cut(s) 109, 271
SetI ASST 4 cut(s) 30, 97, 280, 302
SfaNI GCATC 1 cut(s) 160
SfcI CTRYAG 1 cut(s) 190
Sfr274I CTCGAG 2 cut(s) 295, 489
SlaI CTCGAG 2 cut(s) 295, 489
SmlI CTYRAG 2 cut(s) 295, 489
SmoI CTYRAG 2 cut(s) 295, 489
Sse9I AATT 6 cut(s) 220, 350, 403, 418, 450, 461
SspI AATATT 2 cut(s) 232, 412
StyI CCWWGG 1 cut(s) 117
TaaI ACNGT 1 cut(s) 194
TaqI TCGA 5 cut(s) 274, 296, 302, 368, 490
TasI AATT 6 cut(s) 220, 350, 403, 418, 450, 461
TfiI GAWTC 3 cut(s) 98, 201, 485
Tru1I TTAA 5 cut(s) 81, 219, 393, 441, 453
Tru9I TTAA 5 cut(s) 81, 219, 393, 441, 453
TseI GCWGC 1 cut(s) 278
TspDTI ATGAA 3 cut(s) 17, 60, 193
TspGWI ACGGA 1 cut(s) 104
VspI ATTAAT 1 cut(s) 453
XhoI CTCGAG 2 cut(s) 295, 489
XmiI GTMKAC 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.