Rmu_sc0020916.1_g000001

Belongs to the glycosyl hydrolase 18 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0020916.1
OG0001259
Physical Location & Seq
Forward (+)
1645 .. 3510
1866 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0020916.1_g000001.1.cds

Sequence Viewer

Length: 1044 bp
atggacgacactgatatgctttttggaagaccatggcatgaaagcgtcaaaggtggttattgcaaagacaacacatatttatttaggtgggagtcgcacaaaattaaaatcaagcctggaaggaagaacatcaagaatgaccatcctgaggtgtgtgaaaatgaacatgaagaagccactctgaagattgaagagaaactcagtaaggacaaggaagctgatttattcatcacatcgatatccatgtcatgcatgcctaattgtgttcaagatcaacccaaggagaagtcaatgcccattccttttcaagtggaggagttcaagtttcaagatgcatattctaaacttgtctatggtattggactcatggtgataccttttaatttcgagaatattgaagttgatggcttatcatgttttattcctactaatgatagagctacatgcaagaggaactcgaggtcgagttcttttcaagtggaggagactgatgtacatggaaggaagaacatcaataatgaccatcctgaggtgtgtgaaaaggagcatgaagaagccactctgaagattgaagagaaactcattaaggacaaggaagctgattcattcatcacatcgatatccatgtcatgcatgcctaattgtgttcaagatcaacccaaagagaagtcaatacccattccttttcaagtggaggagttcaagtttcaagatgcatattctaaacatgtctacggtattggacttatggtgataccttttaatttcgagaatattgaagttgatggtttatcatgttttattcctactaatgatcgagctacatacaagaggaactcgaggtcgagttcttttcaagtggaggagactgatgtaggacgatattttagccaatttcaacaaaaaatctcgaaaagaaagaagcgtcttcacattaagaagaataatttgaatattgaaaattgctcatctcatatggctttcgacgctttgacggagcctcttactatcgtgttcacgcttcccgcatcaatctcacattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Glyco_hydro_18

Protein Analysis

347

Amino Acids

40.12

Weight (kDa)

5.74

Isoelectric Point (pI)

54.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 732
AciI CCGC 1 cut(s) 1026
AcuI CTGAAG 2 cut(s) 203, 584
AfaI GTAC 1 cut(s) 495
AfiI CCNNNNNNNGG 2 cut(s) 148, 529
AflIII ACRYGT 1 cut(s) 727
AjnI CCWGG 1 cut(s) 115
AluBI AGCT 4 cut(s) 218, 440, 599, 821
AluI AGCT 4 cut(s) 218, 440, 599, 821
Alw26I GTCTC 2 cut(s) 479, 860
Ama87I CYCGRG 2 cut(s) 457, 838
AsuHPI GGTGA 2 cut(s) 382, 763
AvaI CYCGRG 2 cut(s) 457, 838
AxyI CCTNAGG 2 cut(s) 147, 528
BbsI GAAGAC 2 cut(s) 34, 920
BccI CCATC 4 cut(s) 150, 398, 531, 779
BciT130I CCWGG 1 cut(s) 117
BcoDI GTCTC 2 cut(s) 479, 860
Bme1390I CCNGG 1 cut(s) 117
BmeT110I CYCGRG 2 cut(s) 457, 838
BmiI GGNNCC 1 cut(s) 999
BmrFI CCNGG 1 cut(s) 117
BmsI GCATC 3 cut(s) 322, 703, 1037
BpiI GAAGAC 2 cut(s) 34, 920
Bsa29I ATCGAT 2 cut(s) 236, 617
BsaJI CCNNGG 2 cut(s) 32, 279
BsaXI ACNNNNNCTCC 4 cut(s) 308, 338, 689, 719
Bsc4I CCNNNNNNNGG 2 cut(s) 148, 529
Bse21I CCTNAGG 2 cut(s) 147, 528
BseBI CCWGG 1 cut(s) 117
BseCI ATCGAT 2 cut(s) 236, 617
BseDI CCNNGG 2 cut(s) 32, 279
BseGI GGATG 2 cut(s) 142, 523
BseLI CCNNNNNNNGG 2 cut(s) 148, 529
BseMII CTCAG 3 cut(s) 138, 214, 519
BseRI GAGGAG 4 cut(s) 329, 497, 710, 878
BshVI ATCGAT 2 cut(s) 236, 617
BsiHKCI CYCGRG 2 cut(s) 457, 838
BslI CCNNNNNNNGG 2 cut(s) 148, 529
BsmAI GTCTC 2 cut(s) 479, 860
BsoBI CYCGRG 2 cut(s) 457, 838
Bsp1407I TGTACA 1 cut(s) 493
Bsp143I GATC 3 cut(s) 271, 652, 814
Bsp19I CCATGG 1 cut(s) 32
BspACI CCGC 1 cut(s) 1026
BspCNI CTCAG 3 cut(s) 139, 213, 520
BspDI ATCGAT 2 cut(s) 236, 617
BspLI GGNNCC 1 cut(s) 999
BsrGI TGTACA 1 cut(s) 493
BssECI CCNNGG 2 cut(s) 32, 279
BssMI GATC 3 cut(s) 271, 652, 814
BssT1I CCWWGG 2 cut(s) 32, 279
Bst2UI CCWGG 1 cut(s) 117
Bst4CI ACNGT 1 cut(s) 737
Bst6I CTCTTC 2 cut(s) 186, 567
BstAUI TGTACA 1 cut(s) 493
BstC8I GCNNGC 2 cut(s) 254, 635
BstDEI CTNAG 3 cut(s) 147, 200, 528
BstDSI CCRYGG 1 cut(s) 32
BstF5I GGATG 2 cut(s) 142, 523
BstKTI GATC 3 cut(s) 274, 655, 817
BstMAI GTCTC 2 cut(s) 479, 860
BstMBI GATC 3 cut(s) 271, 652, 814
BstMWI GCNNNNNNNGC 1 cut(s) 986
BstNI CCWGG 1 cut(s) 117
BstNSI RCATGY 4 cut(s) 256, 447, 637, 731
BstSCI CCNGG 1 cut(s) 115
BstV2I GAAGAC 2 cut(s) 34, 920
Bsu15I ATCGAT 2 cut(s) 236, 617
Bsu36I CCTNAGG 2 cut(s) 147, 528
BsuTUI ATCGAT 2 cut(s) 236, 617
BtgI CCRYGG 1 cut(s) 32
BtsCI GGATG 2 cut(s) 142, 523
BtsIMutI CAGTG 1 cut(s) 9
Cac8I GCNNGC 2 cut(s) 254, 635
ClaI ATCGAT 2 cut(s) 236, 617
CseI GACGC 3 cut(s) 34, 914, 995
Csp6I GTAC 1 cut(s) 494
CviQI GTAC 1 cut(s) 494
DdeI CTNAG 3 cut(s) 147, 200, 528
DpnI GATC 3 cut(s) 273, 654, 816
DpnII GATC 3 cut(s) 271, 652, 814
Eam1104I CTCTTC 2 cut(s) 186, 567
EarI CTCTTC 2 cut(s) 186, 567
Eco130I CCWWGG 2 cut(s) 32, 279
Eco32I GATATC 2 cut(s) 240, 621
Eco57I CTGAAG 2 cut(s) 203, 584
Eco81I CCTNAGG 2 cut(s) 147, 528
Eco88I CYCGRG 2 cut(s) 457, 838
EcoRII CCWGG 1 cut(s) 115
EcoRV GATATC 2 cut(s) 240, 621
EcoT14I CCWWGG 2 cut(s) 32, 279
EcoT22I ATGCAT 4 cut(s) 254, 337, 635, 718
ErhI CCWWGG 2 cut(s) 32, 279
FauI CCCGC 1 cut(s) 1033
FauNDI CATATG 1 cut(s) 975
FblI GTMKAC 1 cut(s) 732
FokI GGATG 2 cut(s) 129, 510
HgaI GACGC 3 cut(s) 34, 914, 995
HinfI GANTC 3 cut(s) 92, 363, 602
HphI GGTGA 2 cut(s) 382, 763
Hpy166II GTNNAC 2 cut(s) 733, 1017
Hpy188I TCNGA 2 cut(s) 183, 564
Hpy8I GTNNAC 2 cut(s) 733, 1017
Hpy99I CGWCG 1 cut(s) 989
HpyAV CCTTC 2 cut(s) 114, 495
HpyCH4III ACNGT 1 cut(s) 737
HpyCH4V TGCA 6 cut(s) 63, 252, 335, 447, 633, 716
HpyF10VI GCNNNNNNNGC 1 cut(s) 986
HpyF3I CTNAG 3 cut(s) 147, 200, 528
Kzo9I GATC 3 cut(s) 271, 652, 814
LmnI GCTCC 2 cut(s) 544, 997
LpnPI CCDG 4 cut(s) 102, 129, 159, 540
LweI GCATC 3 cut(s) 322, 703, 1037
MalI GATC 3 cut(s) 273, 654, 816
MboI GATC 3 cut(s) 271, 652, 814
MluCI AATT 8 cut(s) 102, 259, 382, 640, 763, 893, 946, 961
MlyI GAGTC 2 cut(s) 101, 357
Mph1103I ATGCAT 4 cut(s) 254, 337, 635, 718
MseI TTAA 5 cut(s) 105, 381, 585, 762, 936
MslI CAYNNNNRTG 1 cut(s) 14
MspR9I CCNGG 1 cut(s) 117
MvaI CCWGG 1 cut(s) 117
MwoI GCNNNNNNNGC 1 cut(s) 986
NcoI CCATGG 1 cut(s) 32
NdeI CATATG 1 cut(s) 975
NdeII GATC 3 cut(s) 271, 652, 814
NlaIV GGNNCC 1 cut(s) 999
NsiI ATGCAT 4 cut(s) 254, 337, 635, 718
NspI RCATGY 4 cut(s) 256, 447, 637, 731
PaeI GCATGC 2 cut(s) 256, 637
PaeR7I CTCGAG 2 cut(s) 457, 838
PciI ACATGT 1 cut(s) 727
PfeI GAWTC 1 cut(s) 602
PleI GAGTC 2 cut(s) 100, 357
PpsI GAGTC 2 cut(s) 100, 357
PscI ACATGT 1 cut(s) 727
Psp6I CCWGG 1 cut(s) 115
PspGI CCWGG 1 cut(s) 115
PspN4I GGNNCC 1 cut(s) 999
PspXI VCTCGAGB 2 cut(s) 457, 838
RsaI GTAC 1 cut(s) 495
RsaNI GTAC 1 cut(s) 494
RseI CAYNNNNRTG 1 cut(s) 14
SaqAI TTAA 5 cut(s) 105, 381, 585, 762, 936
Sau3AI GATC 3 cut(s) 271, 652, 814
SchI GAGTC 2 cut(s) 101, 357
ScrFI CCNGG 1 cut(s) 117
SfaNI GCATC 3 cut(s) 322, 703, 1037
Sfr274I CTCGAG 2 cut(s) 457, 838
SlaI CTCGAG 2 cut(s) 457, 838
SmiMI CAYNNNNRTG 1 cut(s) 14
SmlI CTYRAG 2 cut(s) 457, 838
SmoI CTYRAG 2 cut(s) 457, 838
SphI GCATGC 2 cut(s) 256, 637
Sse9I AATT 8 cut(s) 102, 259, 382, 640, 763, 893, 946, 961
SsiI CCGC 1 cut(s) 1026
SspI AATATT 3 cut(s) 394, 775, 955
StyD4I CCNGG 1 cut(s) 115
StyI CCWWGG 2 cut(s) 32, 279
TaaI ACNGT 1 cut(s) 737
TasI AATT 8 cut(s) 102, 259, 382, 640, 763, 893, 946, 961
TatI WGTACW 1 cut(s) 493
TfiI GAWTC 1 cut(s) 602
Tru1I TTAA 5 cut(s) 105, 381, 585, 762, 936
Tru9I TTAA 5 cut(s) 105, 381, 585, 762, 936
TscAI CASTG 1 cut(s) 16
TspDTI ATGAA 7 cut(s) 54, 177, 183, 217, 564, 594, 598
TspGWI ACGGA 1 cut(s) 1010
TspRI CASTG 1 cut(s) 16
XceI RCATGY 4 cut(s) 256, 447, 637, 731
XhoI CTCGAG 2 cut(s) 457, 838
XmiI GTMKAC 1 cut(s) 732
Zsp2I ATGCAT 4 cut(s) 254, 337, 635, 718
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.